Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15247

Rimklb ribosomal modification protein rimK-like family member B ( MGI:1918325)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247
"Pseudo-wholemount" of euxassay_010437. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010437_01 euxassay_010437_02 euxassay_010437_03 euxassay_010437_04
EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247
euxassay_010437_05 euxassay_010437_06 euxassay_010437_07 euxassay_010437_08 euxassay_010437_09
EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247
euxassay_010437_10 euxassay_010437_11 euxassay_010437_12 euxassay_010437_13 euxassay_010437_14
EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247 EMAGE:15247
euxassay_010437_15 euxassay_010437_16 euxassay_010437_17 euxassay_010437_18 euxassay_010437_19
EMAGE:15247 EMAGE:15247 EMAGE:15247
euxassay_010437_20 euxassay_010437_21 euxassay_010437_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15247Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15247_wholemount_strong.wlz
15247_wholemount_moderate.wlz
15247_wholemount_weak.wlz
15247_wholemount_possible.wlz
15247_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15247_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 21
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 06 07 20 21
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 20
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 20
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 weak expression: see section 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 16 17 18 19 20
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 weak expression: see section 16 17
spinal cord
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 13 14 weak expression: see section 07 08 09
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 20 21 22
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04 21 22
lower jaw incisor
weak weak
regionalweak expression: see section 07 10 11 13 14 15
lower jaw molar
weak weak
regionalweak expression: see section 06 17
upper jaw incisor
weak weak
regionalweak expression: see section 07 10 11 14 15
upper jaw molar
weak weak
regionalweak expression: see section 06 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30562
Entity Detected:Rimklb, ribosomal modification protein rimK-like family member B ( MGI:1918325)
Sequence:sense strand is shown

>T30562
ATCGTCGCATCAGGGAAGACTACCCACAGAAAGAGATCTTACGAGCGTTGAAGGCCAAATGTTGTGAAGA
GGAATTGGACTTTCGGGCTGTGGTGATGGATGAGATGGTGCTGACGGTCGAGCAAGGAAATCTGGGTCTT
CGGATCAGTGGAGAGCTAATCTCTGCCTACCCACAGGTGGTGGTAGTGAGAGTTCCAACCCCATGGGTGC
AGAGTGATAGTGATATTACTGTTTTGCGCCACCTAGAGAAGATGGGATGCCGATTGATGAACCGACCTCA
AGCCATCCTTAACTGTGTTAATAAATTCTGGACATTCCAAGAGTTAGCTGGCCATGGTGTGCCTCTTCCA
GATACTTTTTCTTACGGTGGCCACGAAAACTTTGCTAAGATGATTGATGAAGCAGAAGTGCTGGAGTTCC
CAATGGTAGTGAAGAATACAAGGGGTCATAGAGGCAAAGCTGTTTTCTTGGCACGAGATAAACACCATTT
AGCGGATCTAAGCCATCTTATTCGGCATGAAGCTCCATATTTGTTCCAGAAATACATTAAAGAGTCTCAT
GGAAGGGATGTACGAGTCATTGTTGTGGGAGGTCGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6402765), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59136. Forward Primer - name:059136_F_IRAV112_a04_4933426K21Rik, sequence:ATCGTCGCATCAGGGAAG; Reverse Primer - name:059136_R_SP6_IRAV112_a04_4933426K21Rik, sequence:CACGACCTCCCACAACAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15249 same embryo
 EMAGE:15251 same embryo
 EMAGE:15248 same embryo
 EMAGE:15250 same embryo
 EurExpress:euxassay_010437 same experiment
 MGI:4827745 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS