Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15251

Zic1 zinc finger protein of the cerebellum 1 ( MGI:106683)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251
"Pseudo-wholemount" of euxassay_010449. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010449_01 euxassay_010449_02 euxassay_010449_03 euxassay_010449_04
EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251
euxassay_010449_05 euxassay_010449_06 euxassay_010449_07 euxassay_010449_08 euxassay_010449_09
EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251
euxassay_010449_10 euxassay_010449_11 euxassay_010449_12 euxassay_010449_13 euxassay_010449_14
EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251 EMAGE:15251
euxassay_010449_15 euxassay_010449_16 euxassay_010449_17 euxassay_010449_18 euxassay_010449_19
EMAGE:15251 EMAGE:15251 EMAGE:15251
euxassay_010449_20 euxassay_010449_21 euxassay_010449_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15251Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15251_wholemount_strong.wlz
15251_wholemount_moderate.wlz
15251_wholemount_weak.wlz
15251_wholemount_possible.wlz
15251_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15251_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 14 15 moderate expression: see section 10 13
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 moderate expression: see section 09 not examined expression: see section 16
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
thalamus mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
thalamus ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
telencephalon mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 moderate expression: see section 05 06 07 08 09 17 18 19 20
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 05 06 12 13 14 15
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 12 13 14 15
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11
medulla oblongata basal plate ventricular layer
moderate moderate
single cellmoderate expression: see section 07
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 14 15 16 17 18 19 moderate expression: see section 06 07 08 09 10 11 12 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 14 15 16 17 18 19 moderate expression: see section 06 07 08 09 10 11 12 13
midbrain meninges
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 not examined expression: see section 18
dorsal grey horn
strong strong
regionalstrong expression: see section 07 08 09 10 11 moderate expression: see section 06 12
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14
neural retina
moderate moderate
regionalmoderate expression: see section 01 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30560
Entity Detected:Zic1, zinc finger protein of the cerebellum 1 ( MGI:106683)
Sequence:sense strand is shown

>T30560
CAGTATCCCGCGATTGGTGTGACCACCTTTGGTGCATCCCGGCACCACTCGGCGGGCGACGTGGCCGAGA
GAGACGTGGGCCTGGGTATCAACCCGTTCGCCGACGGCATGGGCGCCTTCAAGCTCAACCCCAGTTCGCA
CGAACTGGCCTCGGCTGGCCAGACAGCCTTCACGTCGCAGGCTCCGGGCTACGCCGCTGCTGCGGCCCTG
GGCCACCATCACCACCCCGGCCACGTCGGCTCCTACTCCAGCGCTGCTTTCAATTCTACCCGGGACTTTC
TGTTCCGCAACCGGGGCTTCGGCGACGCGGCGGCGGCAGCTAGCGCCCAGCACAGTCTCTTCGCTGCTTC
GGCCGGCGGCTTTGGGGGCCCACACGGCCATACGGACGCCGCGGGCCACCTCCTTTTTTCTGGGCTTCAC
GAGCAGGCGGCTGGCCACGCTTCGCCCAACGTGGTTAACGGGCAGATGCGGCTAGGTTTCTCCGGGGACA
TGTACCCACGGCCGGAACAGTACGGCCAGGTGACCAGCCCGCGATCCGAGCACTATGCTGCCCCGCAGCT
TCACGGCTATGGGCCCATGAACGTGAACATGGCTGCACATCACGGGGCTGGAGCCTTCTTCCGCTATATG
CGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5694793), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59065. Forward Primer - name:059065_F_IRAV111_h07_Zic1, sequence:CAGTATCCCGCGATTGGT; Reverse Primer - name:059065_R_SP6_IRAV111_h07_Zic1, sequence:GGCGCATATAGCGGAAGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15247 same embryo
 EMAGE:15249 same embryo
 EMAGE:15248 same embryo
 EMAGE:15250 same embryo
 EurExpress:euxassay_010449 same experiment
 MGI:4829353 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS