Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15301

Fgf15 fibroblast growth factor 15 ( MGI:1096383)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301
"Pseudo-wholemount" of euxassay_010475. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010475_01 euxassay_010475_02 euxassay_010475_03 euxassay_010475_04
EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301
euxassay_010475_05 euxassay_010475_06 euxassay_010475_07 euxassay_010475_08 euxassay_010475_09
EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301
euxassay_010475_10 euxassay_010475_11 euxassay_010475_12 euxassay_010475_13 euxassay_010475_14
EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301
euxassay_010475_15 euxassay_010475_16 euxassay_010475_17 euxassay_010475_18 euxassay_010475_19
EMAGE:15301 EMAGE:15301 EMAGE:15301 EMAGE:15301
euxassay_010475_20 euxassay_010475_21 euxassay_010475_22 euxassay_010475_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15301Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15301_wholemount_strong.wlz
15301_wholemount_moderate.wlz
15301_wholemount_weak.wlz
15301_wholemount_possible.wlz
15301_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15301_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 11 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
telencephalon mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 moderate expression: see section 17 weak expression: see section 08 18
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 15 16
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 10 11 12 14 20 21 22 moderate expression: see section 13 19 weak expression: see section 06
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 15 16 17
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 13 14 moderate expression: see section 08 15
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 14 15 16 17 18 19 20 moderate expression: see section 08 09 10 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 14 15 16 17 18 19 20 moderate expression: see section 09 10 11 13
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 moderate expression: see section 07 08 15 weak expression: see section 16
dorsal grey horn
strong strong
single cellstrong expression: see section 10 11
retina nuclear layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 22 23
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 weak expression: see section 08 09 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30218
Entity Detected:Fgf15, fibroblast growth factor 15 ( MGI:1096383)
Sequence:sense strand is shown

>T30218
GCCCAGAGAACAGCTCCAGGACCAGAAACCCTCAAACTTTATCCCCGTGTTTCACCGCTCCTTCTTTGAA
ACCGGGGACCAGCTGAGGTCTAAAATGTTCTCCCTGCCCCTGGAGAGTGACAGCATGGATCCGTTCAGGA
TGGTGGAGGATGTAGACCACCTAGTGAAGAGTCCCAGCTTCCAGAAATGACAGGATTCCGACAGGATGGA
GAAAACCCCAAGGTCCCGTGAACTTCCCCCTTAGGAAGCTGTACATATTCTAAGTCTCACATGGACCCTG
TTGTGTTAGTGGCTAGACTTGATCATGAACCTAAATTGACAACCTGCCTGGCTGCCATCGGAGCCCCACT
GACTTTGGAGGCTGCTGATATGTGCCTAAGTTACTCCAGTTCTGTTTGAATACCTCCACTAATAGGGAAC
TTACTCCTGTGAAACATTCTTAGTTTTGAGCCAAATCTGTGACTTGGATGGTTTTAGCGAGGAAGCCAGA
AGGTATGAAGTCAAATGATAAAATTCATGTATAGAAAGTGGGCTCTAAAATATATATTCCCTATATGGAT
CTCATGGGATCTTAGCTTGCCCCCCAAATGTCTCCTGGCCAGAACTAACTGGGGTTACAAAACTTGGAAC
AAAGGACAGCCTAGAAAACTTTGGGAGCCTTGAAGGATGGTCTTAGGATTACGAATTCCAGCTGACTACG
TAGCTTCCCCCTTTTCCACTTATAAATGTCAGATGGAAGTGACCCTTAGCTGAGTGCATAGCCAAGCTGC
CACTTAGGCCCCAGGAGCTTGTCTCTGTCCCATGACCCCAGATTTCCAGGACCTGGATCTTCTCCTCTGA
CCTTTCCCAGAGTTCACCTGGGCTCTCCAACCCCAGAGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5066286), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 24072. Forward Primer - name:024072_F_IRAV55-58_B22_Fgf15, sequence:GCCCAGAGAACAGCTCCA; Reverse Primer - name:024072_R_SP6_IRAV55-58_B22_Fgf15, sequence:TGCTCTGGGGTTGGAGAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15299 same embryo
 EMAGE:15302 same embryo
 EMAGE:15304 same embryo
 EMAGE:15300 same embryo
 EMAGE:15303 same embryo
 EurExpress:euxassay_010475 same experiment
 MGI:4824841 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS