Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15318

Mapk8 mitogen-activated protein kinase 8 ( MGI:1346861)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318
"Pseudo-wholemount" of euxassay_010487. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010487_01 euxassay_010487_02 euxassay_010487_03 euxassay_010487_04
EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318
euxassay_010487_05 euxassay_010487_06 euxassay_010487_07 euxassay_010487_08 euxassay_010487_09
EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318
euxassay_010487_10 euxassay_010487_11 euxassay_010487_12 euxassay_010487_13 euxassay_010487_14
EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318 EMAGE:15318
euxassay_010487_15 euxassay_010487_16 euxassay_010487_17 euxassay_010487_18 euxassay_010487_19
EMAGE:15318
euxassay_010487_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
brain
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
weak weak
regionalweak expression: see section 04 16 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 14 15 16 17 18
vagus x ganglion
weak weak
regionalweak expression: see section 06 13
trigeminal v nerve
weak weak
regionalweak expression: see section 07 14
spinal cord
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 12 13 14 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 19 20
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 07 08 09 10 12 13 14 15 16
Annotation Validation: text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30542
Entity Detected:Mapk8, mitogen-activated protein kinase 8 ( MGI:1346861)
Sequence:sense strand is shown

>T30542
TGTTCCCCGATGTGCTTTTCCCAGCTGACTCAGAGCATAACAAACTTAAAGCCAGTCAGGCAAGAGATTT
GTTATCCAAAATGCTAGTAATAGATGCATCCAAAAGGATCTCCGTAGATGAAGCTCTCCAGCACCCATAC
ATCAACGTCTGGTATGATCCTTCAGAAGCAGAAGCCCCACCACCAAAGATCCCGGACAAGCAGTTAGATG
AGAGGGAGCACACAATAGAGGAGTGGAAAGAACTGATATACAAGGAGGTAATGGATTTGGAGGAACGAAC
TAAGAATGGAGTCATAAGAGGGCAGCCGTCTCCTTTAGGTGCAGCAATGATCAATGGCTCTCAGCATCCA
TCGTCTTCGCCGTCTGTCAATGACATGTCTTCAATGTCCACAGATCCGACTTTGGCCTCGGATACAGACA
GCAGTCTAGAAGCATCAGCTGGACCTCTGGGCTGCTGTAGATGACTACTTGGGCCTTGGGTGGGTGGGAG
GGATGGGGAATTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5694771), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60675. Forward Primer - name:060675_F_IRAV111_b04_Mapk8, sequence:TGTTCCCCGATGTGCTTT; Reverse Primer - name:060675_R_SP6_IRAV111_b04_Mapk8, sequence:ACCAATTCCCCATCCCTC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15322 same embryo
 EMAGE:15321 same embryo
 EMAGE:15320 same embryo
 EMAGE:15319 same embryo
 EMAGE:15317 same embryo
 EurExpress:euxassay_010487 same experiment
 MGI:4826093 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS