Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15326

Camk2d calcium/calmodulin-dependent protein kinase II, delta ( MGI:1341265)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326
"Pseudo-wholemount" of euxassay_010500. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010500_01 euxassay_010500_02 euxassay_010500_03 euxassay_010500_04
EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326
euxassay_010500_05 euxassay_010500_06 euxassay_010500_07 euxassay_010500_08 euxassay_010500_09
EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326
euxassay_010500_10 euxassay_010500_11 euxassay_010500_12 euxassay_010500_13 euxassay_010500_14
EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326 EMAGE:15326
euxassay_010500_15 euxassay_010500_16 euxassay_010500_17 euxassay_010500_18 euxassay_010500_19
EMAGE:15326 EMAGE:15326
euxassay_010500_20 euxassay_010500_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15326Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15326_wholemount_strong.wlz
15326_wholemount_moderate.wlz
15326_wholemount_weak.wlz
15326_wholemount_possible.wlz
15326_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15326_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 moderate expression: see section 09 10 11 12 13 14 15 16 17 18
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 15 moderate expression: see section 07 08 09 10 13 14
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 15 16 17 18 19 20 21 moderate expression: see section 11 14
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 17 18 19 20
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 15 16 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 16
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07
spinal cord mantle layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 12 13 14 15
heart ventricle
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30501
Entity Detected:Camk2d, calcium/calmodulin-dependent protein kinase II, delta ( MGI:1341265)
Sequence:sense strand is shown

>T30501
CAGGGACCTGAAGCCTGAGAATTTGCTTTTAGCTAGCAAGTCCAAAGGAGCAGCTGTGAAGCTGGCAGAC
TTCGGCTTAGCCATAGAAGTTCAAGGCGACCAGCAGGCATGGTTTGGTTTTGCTGGCACACCTGGGTATC
TTTCTCCAGAAGTCCTGCGTAAAGATCCTTATGGAAAACCAGTGGATATGTGGGCATGCGGTGTCATCCT
CTACATCTTGCTGGTGGGATACCCACCCTTCTGGGATGAAGATCAGCATAGACTGTATCAGCAGATCAAG
GCCGGAGCTTATGATTTTCCGTCACCAGAATGGGATACAGTGACACCTGAAGCCAAAGACCTCATCAACA
AAATGCTGACCATCAACCCTGCCAAACGTATCACAGCCTCTGAGGCCCTGAAACACCCATGGATCTGTCA
ACGCTCTACTGTTGCCTCCATGATGCACAGGCAGGAGACTGTAGACTGCTTGAAGAAATTTAATGCTAGA
CGGAAACTGAAGGGCGCCATCTTGACAACTATGCTGGCTACGAGAAATTTTTCAGCAGCCAAGAGTTTAT
TGAAGAAACCAGATGGGGTAAAGGAGTCAACTGAGAGCTCAAACACCACCATTGAGGATGAAGACGTGAA
AGCACGAAAACAGGAGATCATCAAAGTCACTGAGCAACTGATTGAAGCTATCAACAATGGGGACTTTGAG
GCTTACACAAAAATCTGTGATCCAGGCCTCACTGCCTTTGAACCTGAAGCATTGGGTAACTTAGTGGAAG
GGATGGACTTTCACAGATTCTACTTTGAAAATGCTTTGTCCAAAAGCAATAAACCAATCCACACGATCAT
CCTCAACCCACACGTGCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30055337), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 58901. Forward Primer - name:058901_F_IRAV108_f11_Camk2d, sequence:CAGGGACCTGAAGCCTGA; Reverse Primer - name:058901_R_SP6_IRAV108_f11_Camk2d, sequence:GTGCACGTGTGGGTTGAG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15324 same embryo
 EMAGE:15327 same embryo
 EMAGE:15325 same embryo
 EMAGE:15323 same embryo
 EMAGE:15328 same embryo
 EurExpress:euxassay_010500 same experiment
 MGI:4823604 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS