Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15336

Hist2h2aa2 histone cluster 2, H2aa2 ( MGI:2448283)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336
euxassay_010527_01 euxassay_010527_02 euxassay_010527_03 euxassay_010527_04 euxassay_010527_05
EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336
euxassay_010527_06 euxassay_010527_07 euxassay_010527_08 euxassay_010527_09 euxassay_010527_10
EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336
euxassay_010527_11 euxassay_010527_12 euxassay_010527_13 euxassay_010527_14 euxassay_010527_15
EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336
euxassay_010527_16 euxassay_010527_17 euxassay_010527_18 euxassay_010527_19 euxassay_010527_20
EMAGE:15336 EMAGE:15336 EMAGE:15336 EMAGE:15336
euxassay_010527_21 euxassay_010527_22 euxassay_010527_23 euxassay_010527_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15336Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15336_wholemount_strong.wlz
15336_wholemount_moderate.wlz
15336_wholemount_weak.wlz
15336_wholemount_possible.wlz
15336_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15336_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
body cavity or lining
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
limb
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
mesenchyme
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vertebral axis musculature
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
gland
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
visceral organ system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
nervous system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
integumental system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 10 13 14 15 16
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 05 08 10 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16
sensory organ system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cardiovascular system
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
skeleton
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30795
Entity Detected:Hist2h2aa2, histone cluster 2, H2aa2 ( MGI:2448283)
Sequence:sense strand is shown

>T30795
TCTGTTTGCGCTTTCGTGATGTCCGGTCGTGGCAAGCAAGGAGGCAAGGCCCGCGCCAAGGCCAAGTCGC
GGTCTTCCCGGGCCGGGCTACAGTTCCCGGTGGGGCGTGTACACCGGCTGCTGCGCAAGGGCAACTACGC
GGAGCGTGTGGGCGCCGGCGCGCCGGTATACATGGCGGCGGTGCTGGAGTACCTAACGGCCGAGATCCTG
GAGCTGGCGGGCAACGCGGCCCGCGACAACAAGAAGACGCGCATCATCCCGCGCCACCTGCAGCTGGCCA
TCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCAAAGTGACGATCGCGCAGGGCGGCGTCCTGCCCAA
CATCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3582122), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 61844. Forward Primer - name:061844_F_IRAV16-19_H05_Hist2h2aa1, sequence:TCTGTTTGCGCTTTCGTG; Reverse Primer - name:061844_R_SP6_IRAV16-19_H05_Hist2h2aa1, sequence:CTGGATGTTGGGCAGGAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15338 same embryo
 EMAGE:15335 same embryo
 EMAGE:15334 same embryo
 EMAGE:15339 same embryo
 EMAGE:15337 same embryo
 EurExpress:euxassay_010527 same experiment
 MGI:4825379 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS