Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15348

Fmod fibromodulin ( MGI:1328364)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348
"Pseudo-wholemount" of euxassay_010525. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010525_01 euxassay_010525_02 euxassay_010525_03 euxassay_010525_04
EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348
euxassay_010525_05 euxassay_010525_06 euxassay_010525_07 euxassay_010525_08 euxassay_010525_09
EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348
euxassay_010525_10 euxassay_010525_11 euxassay_010525_12 euxassay_010525_13 euxassay_010525_14
EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348
euxassay_010525_15 euxassay_010525_16 euxassay_010525_17 euxassay_010525_18 euxassay_010525_19
EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348 EMAGE:15348
euxassay_010525_20 euxassay_010525_21 euxassay_010525_22 euxassay_010525_23 euxassay_010525_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15348Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15348_wholemount_strong.wlz
15348_wholemount_moderate.wlz
15348_wholemount_weak.wlz
15348_wholemount_possible.wlz
15348_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15348_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18
pericardium
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
greater sac mesothelium
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
omental bursa mesothelium
strong strong
regionalstrong expression: see section 01 02 03 04 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
pleura
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
radius
strong strong
regionalstrong expression: see section 01 02
ulna
strong strong
regionalstrong expression: see section 01 02
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 19 20 21 22 23 24
hand
strong strong
regionalstrong expression: see section 02 03 04 05 06 22 23 24
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 03 04 05 20 22 23
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 04 05 20 22 23
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 03 04 05 20 21 22 23
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 05 20 21 22 23
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 03 04 05 20 21 22 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 03 04 05 20 21 22 23
hindlimb digit 4 mesenchyme
strong strong
regionalstrong expression: see section 03
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 04 05 21 22 23
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 03 04 05 21 22 23
hindlimb digit 5 metatarsal
strong strong
regionalstrong expression: see section 03 04 05 21 22 23
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 03 04 05 21 22 23
fibula
strong strong
regionalstrong expression: see section 01 02 03 04 24
tibia
strong strong
regionalstrong expression: see section 01 02 03 04 24
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 17 18 19 20 21 22 23 24
diencephalon meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 18 19
diencephalon roof plate
strong strong
regionalstrong expression: see section 17
telencephalon meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 moderate expression: see section 02 03 04 05 06
hindbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 03 04 05 06
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 05 06
spinal cord meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
naris
strong strong
regionalstrong expression: see section 15 16
nasal septum
strong strong
regionalstrong expression: see section 14 15
heart valve
strong strong
regionalstrong expression: see section 11 12 13 14 15
hyoid
strong strong
regionalstrong expression: see section 09 10 11
lower jaw
strong strong
regionalstrong expression: see section 02 03 04 05
mandible
strong strong
regionalstrong expression: see section 14 15
lower jaw molar
strong strong
regionalstrong expression: see section 06 07 21 22
upper jaw
strong strong
regionalstrong expression: see section 02 03 04 05
upper jaw molar
strong strong
regionalstrong expression: see section 07 21
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21 22 23 24
axial skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17
temporal bone petrous part
strong strong
regionalstrong expression: see section 04 05
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 03 04 05 06 19 20 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 07 08 09 17 18
scapula
strong strong
regionalstrong expression: see section 02 03 04 05 06 20 21 22 23 24
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
axial skeleton tail region
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30509
Entity Detected:Fmod, fibromodulin ( MGI:1328364)
Sequence:sense strand is shown

>T30509
AGGTGCTACGCCTGGATGGGAACGAGATCAAGCGCAGCGCAATGCCGGTGGACGCCCCACTCTGCCTGCG
CCTCGCCAACCTCATCGAGATCTGAGGGGCCTCGCCTTGGGCTCCTGGCTCCGGGCTCCGAGTACCGTGC
ACCGTGCACCGGGCTCGGGGTACATGCCCTGCCACCCCGCTGCATGTTTGGCTTTTGCTGGATGGTCTGG
GACACGCATGTGACAGAAGTCCACAGGATCTTATTCAATCTCCTTCCAACAGGCAGAGTTAGGTGGGATC
AGGGGCCAGGCCAGTTTCTGCAGGGGGATGAATTTGGTGGTAAAAGAAATATAGCTATAGAGTCTAGCCC
CAAAATCTTCTTGCTTGGACAGTAGCATATAACCAGTTCCAATTTGACCTTTTTTGAGCTGTGCTCAACA
GCATGGCCAGCTGCTTCTGCAGTTGCTCTGGGCTCCTGCTCTTTGCTCCTCAAAACATCACAACACACCT
CTTGCCCAGTCACCTCCTCCCAGCCCCAGCTCACCCTCTCTGCCCTCTTTCACTGGGGCCTCTTCTAATG
TCTTAGGCAGTCAGGAGACACCCACACCCTAAGGGCACACTCTTATCTGAGGCTAAACGGATGGCTAAAA
TCACACACTTACCCCCACCTCACCTGTTTAAAGTCACCATATTGAACACCATAATGATGAGCTGTTAACA
TAGGGGATAACCGACTCTATAATGGAGGATCTATCAGAGGAGGGAAGTGTCCAGTGGTCATTATCAGTAT
CCATAGTAAGATGGGGAAGAGACACACCTCAGGATAGCAGAACTGAAGGGGCAGCCCCCTTTCCAGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:30058603), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60610. Forward Primer - name:060610_F_IRAV109_e03_Fmod, sequence:AGGTGCTACGCCTGGATG; Reverse Primer - name:060610_R_SP6_IRAV109_e03_Fmod, sequence:AAACTGGAAAGGGGGCTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15345 same embryo
 EMAGE:15344 same embryo
 EMAGE:15346 same embryo
 EMAGE:15347 same embryo
 EMAGE:15343 same embryo
 EurExpress:euxassay_010525 same experiment
 MGI:4824886 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS