Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15350

Cyb561 cytochrome b-561 ( MGI:103253)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350
"Pseudo-wholemount" of euxassay_010549. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010549_01 euxassay_010549_02 euxassay_010549_03 euxassay_010549_04
EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350
euxassay_010549_05 euxassay_010549_06 euxassay_010549_07 euxassay_010549_08 euxassay_010549_09
EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350
euxassay_010549_10 euxassay_010549_11 euxassay_010549_12 euxassay_010549_13 euxassay_010549_14
EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350 EMAGE:15350
euxassay_010549_15 euxassay_010549_16 euxassay_010549_17 euxassay_010549_18 euxassay_010549_19
EMAGE:15350 EMAGE:15350 EMAGE:15350
euxassay_010549_20 euxassay_010549_21 euxassay_010549_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15350Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15350_wholemount_strong.wlz
15350_wholemount_moderate.wlz
15350_wholemount_weak.wlz
15350_wholemount_possible.wlz
15350_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15350_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 04 05 06 weak expression: see section 14 15
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 11 12
choroid invagination
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04
pons mantle layer
strong strong
regionalstrong expression: see section 03 13 moderate expression: see section 04 11 12
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 14 15
trigeminal v nerve
strong strong
regionalstrong expression: see section 08 09 14 15 16
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 04 05 06 09 10 11
cervical ganglion
strong strong
regionalstrong expression: see section 04 05 12 13
thoracic ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30819
Entity Detected:Cyb561, cytochrome b-561 ( MGI:103253)
Sequence:sense strand is shown

>T30819
TTTTGGGGTGGTTGTGCTCTACATCTTGGCTCAGGCTGACTGGAAGCGGCCTTCCCAGGCTGAAGAGCAA
GCCCTCTCCATGGACTTCAAGACACTCACGGAGGGAGACAGCCCCAGTCCCCAGTGATCGCCCTCCTTGT
CCTCTTGGCTCTGTGGGTTTCCAGATATCTTTTTGCTCTTCCCTGCAGACACTGAGTCTCTTAGGTCCAG
GAGTGTGAGTGTGGGGCTGTGTTGTTAGTTTAGTGGGGTTCCAGGCTTTGGAGTTGTTCTCAGTCTCCCT
TCCTCCCCTTCCTCTCTGCAGCTTTTGATACATCCTGTGAGCCCTGAGTAGGCTCTGTCTGCCTGTACCC
GCTGTTGTCCGTTCACGTGCAGAAAGCTTGGTTAGGGGATCTGGGGTCAAGCCTGGCCCTGATCCCTATT
GGAGCTAGACAATAGCTCCGCCCTCCATGCAGCAGATGGCTGCTGGGCCTGGGCCTGAGGGACTGGCATG
GAGAAGTCAGACCGCTGCTTTGTGTATTCAACCCAGGAGTTCCAGCAGCTTGGGAAGCATGTGTCCTTGG
CAGTAGAGCAAGTGATATTATGTGTAAAATATGCTGGTGTTCAGAGGAAGGCTCCCCAGAAAGGTTGACT
CTGGCTCCCAAAGGAGCCTTGGCGTGTGGGTTGGCTACAGTCTTTAGGCCTTTCTGTTCTTTTAAAATCC
CTGATCATTAAATAGGCTTTTCGTGGGGAAGGGGATTAGTGATCAAAACTCAGGTAAATACCTGCCCTGG
TGGAGGAGGGCAGGCTGCTTGCTCACAGTGAGGGCTGCCCTGGCAGAGTACCTCCCTTCAGCAGGGGCTA
AGCCCTAGCTTCCTTCTGCGGGCCAGCCTGGGCAGACTCTGAGAGTGGGAGGCCACACCTCCGGAGTTTT
TGGAAGAGGGCTGCTGTTTGCCTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3963612), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 15780. Forward Primer - name:015780_F_IRAV16-19_O12_Cyb561, sequence:TTTTGGGGTGGTTGTGCT; Reverse Primer - name:015780_R_SP6_IRAV16-19_O12_Cyb561, sequence:ACAAGGCAAACAGCAGCC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15351 same embryo
 EMAGE:15353 same embryo
 EMAGE:15352 same embryo
 EMAGE:15354 same embryo
 EMAGE:15349 same embryo
 EurExpress:euxassay_010549 same experiment
 MGI:4824142 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS