Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15400

Comt catechol-O-methyltransferase ( MGI:88470)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400
"Pseudo-wholemount" of euxassay_010574. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010574_01 euxassay_010574_02 euxassay_010574_03 euxassay_010574_04
EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400
euxassay_010574_05 euxassay_010574_06 euxassay_010574_07 euxassay_010574_08 euxassay_010574_09
EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400
euxassay_010574_10 euxassay_010574_11 euxassay_010574_12 euxassay_010574_13 euxassay_010574_14
EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400 EMAGE:15400
euxassay_010574_15 euxassay_010574_16 euxassay_010574_17 euxassay_010574_18 euxassay_010574_19
EMAGE:15400 EMAGE:15400 EMAGE:15400
euxassay_010574_20 euxassay_010574_21 euxassay_010574_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15400Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15400_wholemount_strong.wlz
15400_wholemount_moderate.wlz
15400_wholemount_weak.wlz
15400_wholemount_possible.wlz
15400_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15400_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 07 08 09 10 12 moderate expression: see section 11
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 15 weak expression: see section 05
midbrain mantle layer
moderate moderate
spottedmoderate expression: see section 06 14 weak expression: see section 05
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 16 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 04 05 14 15
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 05 14
basal columns
moderate moderate
regionalmoderate expression: see section 06 07 08 10 11 12 13 14 15 weak expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30845
Entity Detected:Comt, catechol-O-methyltransferase ( MGI:88470)
Sequence:sense strand is shown

>T30845
AACACGCAAAGCCTGGAGACCCCCAGAGCGTCCTGGAGGCCATTGATACCTACTGCTCAGAGAAGGAGTG
GGCCATGAACGTGGGTGACGCAAAAGGCCAAATCATGGATGCAGTGATTCGGGAGTACAGGCCCTCGCTG
GTGCTGGAGCTAGGAGCTTATTGTGGCTACTCAGCCGTGCGAATGGCCCGCCTGCTGCCACCTGGAGCCA
GGCTTCTCACCATGGAGATTAACCCTGACTACGCTGCCATCACCCAGCAAATGCTGGACTTCGCAGGCCT
ACAGGACAAAGTTTCCATCCTCATCGGGGCATCCCAGGACCTTATCCCCCAGCTGAAGAAGAAGTACGAT
GTGGACACATTAGACATGGTCTTTCTTGACCACTGGAAAGACCGCTACCTTCCAGACACACTTCTCCTGG
AGGAATGTGGCCTGCTGCGCAAGGGGACGGTGCTCCTAGCTGACAATGTCATTGTCCCGGGAACCCCTGA
CTTCCTGGCGTATGTGAGGGGGAGCAGCAGCTTCGAGTGCACACACTACAGCTCATACCTGGAGTACATG
AAAGTGGTGGACGGCTTGGAGAAGGCAGTCTACCAGGGTCCAGGCAGCAGCCCCGTGAAGTCCTGACCAC
TCAGCCTGATGAGCTTCCGTCCCAGCTCCCTTCTGCACGATGACACACACTCACTCTGACCCCCTCTATG
CTTCTGGGGCCTTTCCTCAGGGCCTGTGGCTCCAGATTGTCATACACTGGCACATTAAAGGTAGTGAGCT
CACCATGCAAACCACTACAATACCCCTGGAAAACACCTGTGCATCAAAGGCTGCATTGAGGCCAGAGATG
CAGTAGATCACAGTGCGTGCCTGGCACGCAAAACCCCTCACGGTGAATCCTCTGCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4210097), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 16795. Forward Primer - name:016795_F_IRAV20-23_N08_Comt, sequence:AACACGCAAAGCCTGGAG; Reverse Primer - name:016795_R_SP6_IRAV20-23_N08_Comt, sequence:GGTGCAGAGGATTCACCG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15403 same embryo
 EMAGE:15402 same embryo
 EMAGE:15405 same embryo
 EMAGE:15401 same embryo
 EMAGE:15404 same embryo
 EurExpress:euxassay_010574 same experiment
 MGI:4824001 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS