EMAGE mouse gene expression spatial database

EMAGE:15447

Cox7a2 cytochrome c oxidase, subunit VIIa 2 ( MGI:1316715)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_010610. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_010610_01	euxassay_010610_02	euxassay_010610_03	euxassay_010610_04

euxassay_010610_05	euxassay_010610_06	euxassay_010610_07	euxassay_010610_08	euxassay_010610_09

euxassay_010610_10	euxassay_010610_11	euxassay_010610_12	euxassay_010610_13	euxassay_010610_14

euxassay_010610_15	euxassay_010610_16	euxassay_010610_17	euxassay_010610_18	euxassay_010610_19

euxassay_010610_20	euxassay_010610_21	euxassay_010610_22	euxassay_010610_23	euxassay_010610_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T30855
Entity Detected:	Cox7a2, cytochrome c oxidase, subunit VIIa 2 ( MGI:1316715)
Sequence:	sense strand is shown >T30855 CGTCAGATTGCCCAGAGGACCATCAGCACCACTTCACGAAGGCATTTTGAAAACAAGGTTCCAGAGAAAC AAAAGCTGTTTCAGGAGGATAATGGGATGCCAGTTCATCTGAAAGGCGGGGCATCTGATGCCCTCCTCTA CAGAGCCACAATGGCTCTGACGCTTGGTGGCACAGCCTATGCCATCTATCTGTTAGCTATGGCTGCATTT CCCAAGAAGCAGAACTAATGTCGTCATCCCAGTCTTCACGTGGTTCAGTTTCATCAACGCTCGATGGACC AGGAATCTGATGAGTAACTGAGCTCTTCTTTGGGGATCAATATTTATTGATGTGTATTAACTGCTGCCAA TAAAGCAATCC
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4217409), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 16935. Forward Primer - name:016935_F_IRAV24-27_A07_Cox7a2, sequence:CGTCAGATTGCCCAGAGG; Reverse Primer - name:016935_R_SP6_IRAV24-27_A07_Cox7a2, sequence:AGGATTGCTTTATTGGCAGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:6096 same embryo
	EMAGE:15449 same embryo
	EMAGE:15446 same embryo
	EMAGE:15448 same embryo
	EMAGE:15450 same embryo
	EurExpress:euxassay_010610 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source