Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15458

Lifr leukemia inhibitory factor receptor ( MGI:96788)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458
"Pseudo-wholemount" of euxassay_010649. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010649_01 euxassay_010649_02 euxassay_010649_03 euxassay_010649_04
EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458
euxassay_010649_05 euxassay_010649_06 euxassay_010649_07 euxassay_010649_08 euxassay_010649_09
EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458
euxassay_010649_10 euxassay_010649_11 euxassay_010649_12 euxassay_010649_13 euxassay_010649_14
EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458 EMAGE:15458
euxassay_010649_15 euxassay_010649_16 euxassay_010649_17 euxassay_010649_18 euxassay_010649_19
EMAGE:15458 EMAGE:15458
euxassay_010649_20 euxassay_010649_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15458Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15458_wholemount_strong.wlz
15458_wholemount_moderate.wlz
15458_wholemount_weak.wlz
15458_wholemount_possible.wlz
15458_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15458_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 04 05 18 weak expression: see section 19 20
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13
thyroid gland
weak weak
regionalweak expression: see section 10
vibrissa
strong strong
regionalstrong expression: see section 02 03 04 05 16 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 14 moderate expression: see section 15
pons mantle layer
strong strong
regionalstrong expression: see section 07 16
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 17 18
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 15 16 17 18 19 20
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 15 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 14 15 16 moderate expression: see section 12 17
extrinsic ocular muscle
weak weak
regionalweak expression: see section 02 03 04 05 17 18 19
tongue
weak weak
regionalweak expression: see section 09 10 11 12 13
mandible
strong strong
regionalstrong expression: see section 03 17 moderate expression: see section 02 04 05 06 07 08 09 14 15 16 18 weak expression: see section 19 20
maxilla
strong strong
regionalstrong expression: see section 03 moderate expression: see section 04 05 06 07 08 09 14 15 16 18
thyroid cartilage
weak weak
regionalweak expression: see section 11
orbito-sphenoid
strong strong
regionalstrong expression: see section 02 03 19 20 21 moderate expression: see section 01
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31163
Entity Detected:Lifr, leukemia inhibitory factor receptor ( MGI:96788)
Sequence:sense strand is shown

>T31163
TCTGTACGGGCAAACCGTTGCGATCCATATCCTGAACATCCCCGTTTCTGAAAACAGTGGCACAAACATC
ATTTTCATCACAGACGACGATGTGTACGGAACGGTGGTCTTTGCAGGCTATCCTCCCGATGTTCCTCAGA
AGCTGAGCTGTGAGACACATGACTTAAAAGAGATTATATGTAGCTGGAATCCAGGAAGGATAACTGGACT
GGTGGGCCCACGAAATACAGAATACACCCTGTTTGAAAGCATTTCAGGAAAATCGGCAGTATTTCACAGG
ATTGAAGGACTTACAAACGAGACCTACCGGTTAGGCGTGCAAATGCATCCCGGCCAAGAAATCCATAACT
TCACCCTGACTGGTCGCAATCCACTGGGGCAGGCACAGTCAGCAGTGGTCATCAATGTGACTGAGAGAGT
TGCTCCTCATGATCCGACTTCGTTGAAAGTGAAGGACATCAATTCAACAGTTGTTACATTTTCTTGGTAT
TTACCAGGAAATTTTACAAAGATTAATCTTTTATGTCAAATTGAAATTTGTAAAGCTAATTCCAAGAAAG
AAGTGAGGAATGCCACAATCAGAGGAGCCGAGGATTCAACTTACCATGTTGCTGTAGACAAATTAAATCC
ATACACTGCATACACTTTCCGGGTTCGTTGTTCTTCCAAGACTTTCTGGAAGTGGAGCAGGTGGAGTGAT
GAGAAGCGACATCTAACCACAGAAGCCACTCCTTCAAAGGGACCAGACACTTGGAGAGAGTGGAGTTCTG
ATGGAAAAAATCTAATCGTCTACTGGAAGCCTTTACCTATTAATGAAGCTAATGGAAAAATACTTTCCTA
CAATGTTTCGTGTTCATTGAACGAGGAGACACAGTCAGTTTTGGAGATCTTCGATCCTCAACACAGAGCA
GAGATACAGCTTAGTAAAAATGACTACATCATCAGTGTGGTGGCAAGAAATTCTGCTGGCTCATCACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4159053), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 53553. Forward Primer - name:053553_F_IRAV45_f03_Lifr, sequence:TCTGTACGGGCAAACCGT; Reverse Primer - name:053553_R_SP6_IRAV45_f03_Lifr, sequence:TGGTGATGAGCCAGCAGA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15463 same embryo
 EMAGE:15462 same embryo
 EMAGE:15461 same embryo
 EMAGE:15460 same embryo
 EMAGE:15459 same embryo
 EurExpress:euxassay_010649 same experiment
 MGI:4825922 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS