Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15556

Fmo6 flavin containing monooxygenase 6 ( MGI:2681841)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556
"Pseudo-wholemount" of euxassay_010800. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010800_01 euxassay_010800_02 euxassay_010800_03 euxassay_010800_04
EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556
euxassay_010800_05 euxassay_010800_06 euxassay_010800_07 euxassay_010800_08 euxassay_010800_09
EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556
euxassay_010800_10 euxassay_010800_11 euxassay_010800_12 euxassay_010800_13 euxassay_010800_14
EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556 EMAGE:15556
euxassay_010800_15 euxassay_010800_16 euxassay_010800_17 euxassay_010800_18 euxassay_010800_19
EMAGE:15556 EMAGE:15556 EMAGE:15556
euxassay_010800_20 euxassay_010800_21 euxassay_010800_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15556Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15556_wholemount_strong.wlz
15556_wholemount_moderate.wlz
15556_wholemount_weak.wlz
15556_wholemount_possible.wlz
15556_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15556_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 12 14 15 moderate expression: see section 11 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38356
Entity Detected:Fmo6, flavin containing monooxygenase 6 ( MGI:2681841)
Sequence:sense strand is shown

>T38356
ATGATCTGTTCAGGACATCACGTGTACCCCAACATGCCAACTGACTCTTTTCCCGGTCTAGAGCACTTTC
GAGGCAAGTGCCTACACAGCCGGGATTACAAGGGCCCAGGAGCCTTCCAGGGAAAGAAAGTCCTTGTGAT
TGGCCTGGGAAACTCAGCATCCGACATTGCTGTTGAGCTCAGTCGTCTGGCTACACAGGTCATCATCAGC
ACCAGAAGCGGTTCCTGGATCATGAGTCGAGTTTGGAATGATGGGTATCCTTGGGATATGGTATATGTTA
CCCGATTCACATCCTTCCTCCGGAATATCCTTCCTTCTTTTGTCTCTGACTGGTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 106347. Forward Primer - name:106347_F_cDNA_LOC226565, sequence:ATGATCTGTTCAGGACATCACG; Reverse Primer - name:106347_N_SP6_cDNA_LOC226565, sequence:AACCAGTCAGAGACAAAAGAAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15552 same embryo
 EMAGE:15553 same embryo
 EMAGE:15555 same embryo
 EMAGE:15557 same embryo
 EMAGE:15554 same embryo
 EurExpress:euxassay_010800 same experiment
 MGI:4824885 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS