Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15606

Spint2 serine protease inhibitor, Kunitz type 2 ( MGI:1338031)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606
"Pseudo-wholemount" of euxassay_010770. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010770_01 euxassay_010770_02 euxassay_010770_03 euxassay_010770_04
EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606
euxassay_010770_05 euxassay_010770_06 euxassay_010770_07 euxassay_010770_08 euxassay_010770_09
EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606
euxassay_010770_10 euxassay_010770_11 euxassay_010770_12 euxassay_010770_13 euxassay_010770_14
EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606 EMAGE:15606
euxassay_010770_15 euxassay_010770_16 euxassay_010770_17 euxassay_010770_18 euxassay_010770_19
EMAGE:15606 EMAGE:15606 EMAGE:15606
euxassay_010770_20 euxassay_010770_21 euxassay_010770_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15606Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15606_wholemount_strong.wlz
15606_wholemount_moderate.wlz
15606_wholemount_weak.wlz
15606_wholemount_possible.wlz
15606_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15606_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
thymus primordium
strong strong
regionalstrong expression: see section 11 12 13 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 15 16 17 18
pancreas
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13
thyroid gland
strong strong
regionalstrong expression: see section 10 11 15
pituitary gland
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 07 08 19 20 21 22
diencephalon roof plate
strong strong
regionalstrong expression: see section 11 12 13
choroid invagination
strong strong
regionalstrong expression: see section 06 07 08 09 10 14 15 16 17
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 10 14 15
metencephalon part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
ear
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 21 22
cochlea
strong strong
regionalstrong expression: see section 08 09 16 17
utricle
strong strong
regionalstrong expression: see section 05 06 07 08 17 18 19 20
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 16 17 18 19 20 21 22
cornea
strong strong
regionalstrong expression: see section 01 02 03 04 21 22
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 11 12 14 15 16 17 18
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
vomeronasal organ
strong strong
regionalstrong expression: see section 12
heart ventricle
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
esophagus epithelium
strong strong
regionalstrong expression: see section 10 11 12
pharynx epithelium
strong strong
regionalstrong expression: see section 11 12 13
stomach
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09
rectum
strong strong
regionalstrong expression: see section 11
midgut
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16
lower jaw molar
strong strong
regionalstrong expression: see section 07 19
oral epithelium
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 11 12 15 16 17
upper jaw molar
strong strong
regionalstrong expression: see section 07 19
urinary system
strong strong
regionalstrong expression: see section 03 04 17 18 19
bladder
strong strong
regionalstrong expression: see section 11 12
metanephros
strong strong
regionalstrong expression: see section 08
kidney calyx
strong strong
regionalstrong expression: see section 05 06 07 08 09 14 15 16 17
kidney pelvis
strong strong
regionalstrong expression: see section 07
male reproductive system
strong strong
regionalstrong expression: see section 11 12 13
urethra of male
strong strong
regionalstrong expression: see section 11
larynx
strong strong
regionalstrong expression: see section 12 13
left lung
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10
right lung
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20 21
trachea epithelium
strong strong
regionalstrong expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38322
Entity Detected:Spint2, serine protease inhibitor, Kunitz type 2 ( MGI:1338031)
Sequence:sense strand is shown

>T38322
CTACCAGAGCAAGGAGGAGTGTCTTGACAAGTGTGCTGGTGTCACTGAGAACACCACTGATGACATGGCC
AGGAACAGGAATGGAGCCGACTCTTCTGTCCTGAGTGTTCCCAGAAAGCAGAGTGCTGAGGACCTGTCTG
CTGAGATCTTCAACTATGAAGAATATTGTGTCCCGAAGGCCGTCACTGGGCCGTGCCGCGCAGCCTTCCC
TCGCTGGTACTATGACACTGAAAAGAATTCCTGTATCAGCTTCATCTACGGCGGGTGCAGAGGCAACAAG
AACAGTTACCTCTCCCAGGAAGCATGCATGCAGCACTGCTCAGGTAAGCAGATGCATCCTTTCCTGACCC
CGGGCCTAAAAGCGGTGATCCTGGTGGGGCTGTTCCTCATGGTTCTGATCCTCCTCCTGGGAACCTCTAT
GGTCTGCCTCATCCGTGTGGTTCGCAGAAAGCAGGAGCGTGCGCTGCGCACTGTTTGGAGCACTGCGGAT
GACAAGGAGCAGCTGGTGAAGAACACCTGTGTCTTGTAGAGGCCCCAGTGCTCAGAACCGGGAGTACAAC
TTGTGCTGTTTAAAAAGAGAGCAACTGCTTGCGTCTGAGATCATTAGGGGTTTGGTCTTTGTTTCCCAGT
GCTGTTGGGCTGCTTAGGGCCTCCTCTTGACCCTGTCCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 141732. Forward Primer - name:141732_F_cDNA_Spint2, sequence:CTACCAGAGCAAGGAGGAGTGT; Reverse Primer - name:141732_N_SP6_cDNA_Spint2, sequence:GGAGGACAGGGTCAAGAGGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15602 same embryo
 EMAGE:15605 same embryo
 EMAGE:15607 same embryo
 EMAGE:15604 same embryo
 EMAGE:15603 same embryo
 EurExpress:euxassay_010770 same experiment
 MGI:4828414 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS