Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15648

Mfge8 milk fat globule-EGF factor 8 protein ( MGI:102768)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648
"Pseudo-wholemount" of euxassay_010873. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010873_01 euxassay_010873_02 euxassay_010873_03 euxassay_010873_04
EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648
euxassay_010873_05 euxassay_010873_06 euxassay_010873_07 euxassay_010873_08 euxassay_010873_09
EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648
euxassay_010873_10 euxassay_010873_11 euxassay_010873_12 euxassay_010873_13 euxassay_010873_14
EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648
euxassay_010873_15 euxassay_010873_16 euxassay_010873_17 euxassay_010873_18 euxassay_010873_19
EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648 EMAGE:15648
euxassay_010873_20 euxassay_010873_21 euxassay_010873_22 euxassay_010873_23 euxassay_010873_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15648Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15648_wholemount_strong.wlz
15648_wholemount_moderate.wlz
15648_wholemount_weak.wlz
15648_wholemount_possible.wlz
15648_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15648_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 16 17 18
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 14 weak expression: see section 13
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 15 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 14 15 16 moderate expression: see section 07 08 weak expression: see section 13
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 08
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 02 03 23 weak expression: see section 01 04 17 18 19 20 21 22 24
cornea epithelium
weak weak
regionalweak expression: see section 04 05 23 24
esophagus
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12
stomach
moderate moderate
regionalmoderate expression: see section 01 02 03 weak expression: see section 04 06 07 08
meckel's cartilage
weak weak
regionalweak expression: see section 12 13 14 15
ovary
moderate moderate
regionalmoderate expression: see section 04 19 weak expression: see section 05 18 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38874
Entity Detected:Mfge8, milk fat globule-EGF factor 8 protein ( MGI:102768)
Sequence:sense strand is shown

>T38874
TAACATGTTCAACCCGACTCTGGAGGCACAGTACATAAGGCTGTACCCTGTTTCGTGCCACCGCGGCTGC
ACCCTCCGCTTCGAGCTCCTGGGCTGTGAGTTGCACGGATGTTCTGAGCCCCTGGGCCTGAAGAATAACA
CAATTCCTGACAGCCAGATGTCAGCCTCCAGCAGCTACAAGACATGGAACCTGCGTGCTTTTGGCTGGTA
CCCCCACTTGGGAAGGCTGGATAATCAGGGCAAGATCAATGCCTGGACGGCTCAGAGCAACAGTGCCAAG
GAATGGCTGCAGGTTGACCTGGGCACTCAGAGGCAAGTGACAGGAATCATCACCCAGGGGGCCCGTGACT
TTGGCCACATCCAGTATGTGGCGTCCTACAAGGTAGCCCACAGTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 178156. Forward Primer - name:178156_F_cDNA_Mfge8, sequence:TAACATGTTCAACCCGACTCTG; Reverse Primer - name:178156_N_SP6_cDNA_Mfge8, sequence:TCACTGTGGGCTACCTTGTAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15645 same embryo
 EMAGE:15646 same embryo
 EMAGE:15647 same embryo
 EMAGE:15649 same embryo
 EMAGE:15644 same embryo
 EurExpress:euxassay_010873 same experiment
 MGI:4826177 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS