EMAGE mouse gene expression spatial database

EMAGE:15687

Adra2c adrenergic receptor, alpha 2c ( MGI:87936)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_010850. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_010850_01	euxassay_010850_02	euxassay_010850_03	euxassay_010850_04

euxassay_010850_05	euxassay_010850_06	euxassay_010850_07	euxassay_010850_08	euxassay_010850_09

euxassay_010850_10	euxassay_010850_11	euxassay_010850_12	euxassay_010850_13	euxassay_010850_14

euxassay_010850_15	euxassay_010850_16	euxassay_010850_17	euxassay_010850_18	euxassay_010850_19

euxassay_010850_20	euxassay_010850_21	euxassay_010850_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T38433
Entity Detected:	Adra2c, adrenergic receptor, alpha 2c ( MGI:87936)
Sequence:	sense strand is shown >T38433 GAACCTCTTCCTGGTGTCTCTGGCCTCAGCTGACATCCTGGTGGCCACACTGGTCATGCCCTTTTCTCTG GCCAATGAGCTCATGGCCTACTGGTACTTCGGGCAAGTGTGGTGTGGTGTATACCTGGCACTGGACGTGC TCTTCTGCACCTCGTCCATCGTGCACCTGTGTGCCATTAGTCTGGACCGCTACTGGTCGGTGACGCAAGC GGTAGAGTACAACCTGAAGCGCACGCCGCGCCGTGTCAAGGCCACCATCGTGGCCGTGTGGCTCATCTCC GCTGTCATCTCCTTCCCGCCTCTCGTCTCGTTCTACCGCCGGCCCGACGTCGCCGCCTATCCGCAGTGCG GCCTCAACGATGAGACCTGGTACATCT
Notes:	The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 149891. Forward Primer - name:149891_F_cDNA_Adra2c, sequence:GAACCTCTTCCTGGTGTCTCTG; Reverse Primer - name:149891_N_SP6_cDNA_Adra2c, sequence:AGATGTACCAGGTCTCATCGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:15690 same embryo
	EMAGE:15689 same embryo
	EMAGE:15688 same embryo
	EMAGE:15686 same embryo
	EMAGE:15685 same embryo
	EurExpress:euxassay_010850 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source