Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15690

Adra2a adrenergic receptor, alpha 2a ( MGI:87934)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690
"Pseudo-wholemount" of euxassay_010849. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010849_01 euxassay_010849_02 euxassay_010849_03 euxassay_010849_04
EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690
euxassay_010849_05 euxassay_010849_06 euxassay_010849_07 euxassay_010849_08 euxassay_010849_09
EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690
euxassay_010849_10 euxassay_010849_11 euxassay_010849_12 euxassay_010849_13 euxassay_010849_14
EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690 EMAGE:15690
euxassay_010849_15 euxassay_010849_16 euxassay_010849_17 euxassay_010849_18 euxassay_010849_19
EMAGE:15690 EMAGE:15690 EMAGE:15690
euxassay_010849_20 euxassay_010849_21 euxassay_010849_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15690Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15690_wholemount_strong.wlz
15690_wholemount_moderate.wlz
15690_wholemount_weak.wlz
15690_wholemount_possible.wlz
15690_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15690_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18 weak expression: see section 12 16
not examined not examined
regionalnot examined expression: see section 10
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 11 12
pons mantle layer
moderate moderate
single cellmoderate expression: see section 17 weak expression: see section 07 08 16
ventral grey horn
moderate moderate
single cellmoderate expression: see section 09 13 14 weak expression: see section 11
naris
moderate moderate
regionalmoderate expression: see section 13 14
nasal capsule
moderate moderate
regionalmoderate expression: see section 15
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 14 15 weak expression: see section 10 11 12 16 17 18 19
basisphenoid bone
strong strong
regionalstrong expression: see section 03 22 moderate expression: see section 04 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38432
Entity Detected:Adra2a, adrenergic receptor, alpha 2a ( MGI:87934)
Sequence:sense strand is shown

>T38432
TGTGGTGTGAGATCTATTTGGCTCTCGACGTGCTCTTTTGCACGTCGTCCATAGTGCACCTGTGCGCCAT
CAGCCTTGACCGCTACTGGTCCATCACGCAGGCCATCGAGTACAACCTGAAGCGCACGCCGCGTCGCATC
AAGGCCATCATTGTCACCGTGTGGGTCATCTCGGCTGTCATCTCCTTCCCGCCACTCATCTCCATAGAGA
AGAAGGGCGCTGGCGGCGGGCAGCAGCCGGCCGAGCCAAGCTGCAAGATCAACGACCAGAAGTGGTATGT
CATCTCCTCGTCCATCGGTTCCTTCTTCGCGCCTTGCCTCATCATGATCCTGGTCTACGTGCGTATTTAC
CAGATCGCCAAGCGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150536. Forward Primer - name:150536_F_cDNA_Adra2a, sequence:TGTGGTGTGAGATCTATTTGGC; Reverse Primer - name:150536_N_SP6_cDNA_Adra2a, sequence:ACGCTTGGCGATCTGGTAAATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15687 same embryo
 EMAGE:15689 same embryo
 EMAGE:15688 same embryo
 EMAGE:15686 same embryo
 EMAGE:15685 same embryo
 EurExpress:euxassay_010849 same experiment
 MGI:4823014 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS