Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15718

Sall3 sal-like 3 (Drosophila) ( MGI:109295)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718
"Pseudo-wholemount" of euxassay_010911. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010911_01 euxassay_010911_02 euxassay_010911_03 euxassay_010911_04
EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718
euxassay_010911_05 euxassay_010911_06 euxassay_010911_07 euxassay_010911_08 euxassay_010911_09
EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718
euxassay_010911_10 euxassay_010911_11 euxassay_010911_12 euxassay_010911_13 euxassay_010911_14
EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718
euxassay_010911_15 euxassay_010911_16 euxassay_010911_17 euxassay_010911_18 euxassay_010911_19
EMAGE:15718 EMAGE:15718 EMAGE:15718 EMAGE:15718
euxassay_010911_20 euxassay_010911_21 euxassay_010911_22 euxassay_010911_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15718Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15718_wholemount_strong.wlz
15718_wholemount_moderate.wlz
15718_wholemount_weak.wlz
15718_wholemount_possible.wlz
15718_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15718_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 12 13 14 15 16
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 16 17 19 20 23
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 21 22 23
medulla oblongata
moderate moderate
regionalmoderate expression: see section 06
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13
midbrain mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 15 16 17 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12
inner ear
strong strong
regionalstrong expression: see section 20 21
cochlea
strong strong
regionalstrong expression: see section 08 15 16
utricle
strong strong
regionalstrong expression: see section 03 04 05 06 07 17 18 19
heart valve
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12
lower lip
moderate moderate
regionalmoderate expression: see section 08 09 18 19
upper lip
moderate moderate
regionalmoderate expression: see section 08 09 19
palatal shelf
moderate moderate
regionalmoderate expression: see section 10 11 14
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 08 09 10 18 19
genital tubercle of male
moderate moderate
regionalmoderate expression: see section 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38908
Entity Detected:Sall3, sal-like 3 (Drosophila) ( MGI:109295)
Sequence:sense strand is shown

>T38908
CCTCAGTACAGCTTCAGGGTCTGACTCCCCATGCGGCCCTCCAGCTTTCTGCTGGCCCTGCCACTGCCTC
TGCTGGCTCGGGCTCCACGCTGCCGGCAGCCTTCGATGGCCCCCAGCACCTGTCACAGCCTGCATCCGGC
ACAAGCACTCCCTGCAGCACCAGTGCTGCCCCCCCTGATTCTGGGGCACACCCAGCCTGTAGCACTGGCC
CAGCTCCAGGAGCCGTGGCCGCTGCATCCAGCACTGTAGGCAACGCGGTGCAGCCCCAAAATGCATCCAC
GCCCCCTGCCCTGGGTCCTGGACCCCTCCTCAGCTCAGCCTCCAATCTGCCAAACCCTCTGCTACCTCAG
ACTTCATCCAGCAGTGTCATCTTCCCCAACCCGCTGGTTAGCATTGCTGCCACCGCCAATGCCCTGGATC
CCCTGTCGGCTCTGATGAAGCACCGCAAGGGCAAGCCCCCTAATGTTTCAGTGTTCGAGCCCAAGGCCAG
TGCCGAGGACCCTTTCTTTAAGCACAAGTGCAGGTTCTGTGCCAAGGTCTTCGGCAGTGACAGTGCGTTG
CAGATCCACCTACGATCCCACACAGGGGAGCGGCCCTTCAAATGTAACATCTGCGGGAACCGCTTTTCCA
CCAAGGGCAACCTGAAGGTCCACTTTCAGAGGCACAAGGAGAAGTACCCCCACATCCAGATGAACCCCTA
CCCTGTCCCAGAATACCTCGACAATGTGCCCACCTGCTCTGGGATCCCCTATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 267647. Forward Primer - name:267647_F_cDNA_Sall3, sequence:CCTCAGTACAGCTTCAGGGTCT; Reverse Primer - name:267647_N_SP6_cDNA_Sall3, sequence:CATAGGGGATCCCAGAGCAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15723 same embryo
 EMAGE:15721 same embryo
 EMAGE:15720 same embryo
 EMAGE:15722 same embryo
 EMAGE:15719 same embryo
 EurExpress:euxassay_010911 same experiment
 MGI:4827859 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS