Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15740

Ttbk2 tau tubulin kinase 2 ( MGI:2155779)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740
"Pseudo-wholemount" of euxassay_010933. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010933_01 euxassay_010933_02 euxassay_010933_03 euxassay_010933_04
EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740
euxassay_010933_05 euxassay_010933_06 euxassay_010933_07 euxassay_010933_08 euxassay_010933_09
EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740
euxassay_010933_10 euxassay_010933_11 euxassay_010933_12 euxassay_010933_13 euxassay_010933_14
EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740
euxassay_010933_15 euxassay_010933_16 euxassay_010933_17 euxassay_010933_18 euxassay_010933_19
EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740 EMAGE:15740
euxassay_010933_20 euxassay_010933_21 euxassay_010933_22 euxassay_010933_23 euxassay_010933_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15740Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15740_wholemount_strong.wlz
15740_wholemount_moderate.wlz
15740_wholemount_weak.wlz
15740_wholemount_possible.wlz
15740_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15740_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 14 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39018
Entity Detected:Ttbk2, tau tubulin kinase 2 ( MGI:2155779)
Sequence:sense strand is shown

>T39018
GATCGTTTCAACTACGTGGTCATGCAATTGCAGGGACGGAATCTGGCAGATCTCCGCCGTAGCCAATCCC
GGGGCACATTCACTATTAGCACTACCCTTCGTCTTGGGAAACAGATTCTGGAGTCTATTGAAAGCATACA
TTCTGTGGGATTCCTTCACAGAGACATCAAACCGTCAAACTTCGCCATGGGACGTTTCCCCAGTACATGT
AGGAAATGTTTCATGCTTGATTTTGGCTTGGCTCGACAATTTACTAATTCCTGTGGTGACGTCAGACCAC
CTCGTGCTGTGGCAGGCTTTCGAGGGACAGTTCGTTATGCATCAATCAATGCTCATCGGAACAGGGAAAT
GGGAAGACATGATGACCTTTGGTCTTTATTCTACATGTTGGTGGAGTTTGTGGTTGGCCAACTGCCTTGG
AGAAAAATAAAGGACAAGGAGCAAGTAGGCTCCATTAAGGAGAGATATGACCACAGGCTCATGTTAAAAC
ACCTCCCTCCAGAATTCAGCACCTTTCTTGACCATATTTCCTCTTTGGATTATTTTACAAAACCGGACTA
CCAGCTTCTAACATCCGTGTTTGACAATAGCATCAAGACCTTTGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 268682. Forward Primer - name:268682_F_cDNA_Ttbk1, sequence:GATCGTTTCAACTACGTGGTCA; Reverse Primer - name:268682_N_SP6_cDNA_Ttbk1, sequence:CTCCAAAGGTCTTGATGCTATTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15737 same embryo
 EMAGE:15741 same embryo
 EMAGE:15738 same embryo
 EMAGE:15739 same embryo
 EMAGE:15736 same embryo
 EurExpress:euxassay_010933 same experiment
 MGI:4828976 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS