Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15801

Clec3a C-type lectin domain family 3, member a ( MGI:2685642)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801
"Pseudo-wholemount" of euxassay_013204. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013204_01 euxassay_013204_02 euxassay_013204_03 euxassay_013204_04
EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801
euxassay_013204_05 euxassay_013204_06 euxassay_013204_07 euxassay_013204_08 euxassay_013204_09
EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801
euxassay_013204_10 euxassay_013204_11 euxassay_013204_12 euxassay_013204_13 euxassay_013204_14
EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801 EMAGE:15801
euxassay_013204_15 euxassay_013204_16 euxassay_013204_17 euxassay_013204_18 euxassay_013204_19
EMAGE:15801 EMAGE:15801 EMAGE:15801
euxassay_013204_20 euxassay_013204_21 euxassay_013204_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15801Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15801_wholemount_strong.wlz
15801_wholemount_moderate.wlz
15801_wholemount_weak.wlz
15801_wholemount_possible.wlz
15801_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15801_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cervical intervertebral disc
moderate moderate
regionalmoderate expression: see section 11 12 13
lumbar intervertebral disc
moderate moderate
regionalmoderate expression: see section 11 12 13
thoracic intervertebral disc
moderate moderate
regionalmoderate expression: see section 11 12 13
sacral vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 12 13
exoccipital bone
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 03 04 16
sternum
moderate moderate
regionalmoderate expression: see section 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39320
Entity Detected:Clec3a, C-type lectin domain family 3, member a ( MGI:2685642)
Sequence:sense strand is shown

>T39320
GGCTACCCATCTCGAATGAAAGCCAGGAAACACAGCAAACGCCGCGTGAAAGCAAAGGATGACGACCTGA
AATCTCAAGTTGAAAAGCTGTGGCGGGAAGTCAACGCCTTGAAGGAAATGCAAGCTCTGCAGACAGTCTG
TCTCCGAGGCACCAAAGTTCATAAGAAGTGCTACCTTGCTTCAGAAGGCCTCAAGCATTACCACGAAGCC
AACGAAGACTGCATTTCCAAGGGAGGGACCCTGGTTGTCCCCAGGAATTCCGACGAAATCAATGCCCTTC
GAGACTATGGTAAGAGGAGTCTGCCAGGTGTCAATGACTTTTGGCTAGGCATAAATGACATGGTCACAGA
AGGCAAGTTCCTCGATGTCCACGGATTCGCTGTCTCCTTCCTCAACTGGGACCGTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 277909. Forward Primer - name:277909_F_cDNA_Clec3a, sequence:GGCTACCCATCTCGAATGAA; Reverse Primer - name:277909_N_SP6_cDNA_Clec3a, sequence:CACGGTCCCAGTTGAGGAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15802 same embryo
 EMAGE:15800 same embryo
 EurExpress:euxassay_013204 same experiment
 MGI:4823923 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS