Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15845

Gm9580 predicted gene 9580 ( MGI:3811203)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845
euxassay_013273_01 euxassay_013273_02 euxassay_013273_03 euxassay_013273_04 euxassay_013273_05
EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845
euxassay_013273_06 euxassay_013273_07 euxassay_013273_08 euxassay_013273_09 euxassay_013273_10
EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845
euxassay_013273_11 euxassay_013273_12 euxassay_013273_13 euxassay_013273_14 euxassay_013273_15
EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845 EMAGE:15845
euxassay_013273_16 euxassay_013273_17 euxassay_013273_18 euxassay_013273_19 euxassay_013273_20
EMAGE:15845 EMAGE:15845 EMAGE:15845
euxassay_013273_21 euxassay_013273_22 euxassay_013273_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15845Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15845_wholemount_strong.wlz
15845_wholemount_moderate.wlz
15845_wholemount_weak.wlz
15845_wholemount_possible.wlz
15845_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15845_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39880
Entity Detected:Gm9580, predicted gene 9580 ( MGI:3811203)
Sequence:sense strand is shown

>T39880
ATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGC
CTACCCTACGCCGGCAGGCGCGGGTAACCCGTTGAACCCCATTCGTGATGGGGATCGGGGATTGCAATTA
TTCCCCATGAACGAGGAATTCCCAGTAAGTGCGGGCCATAAGCTTGCGTTGATTAAGTCCCTGCCCTTTG
TACACAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 111187. Forward Primer - name:111187_F_cDNA_LOC385068, sequence:ATAACAGGTCTGTGATGCCCTT; Reverse Primer - name:111187_N_SP6_cDNA_LOC385068, sequence:GTGTGTACAAAGGGCAGGGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15847 same embryo
 EMAGE:15842 same embryo
 EMAGE:15846 same embryo
 EMAGE:15843 same embryo
 EMAGE:15844 same embryo
 EurExpress:euxassay_013273 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS