Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15889

Plcxd2 phosphatidylinositol-specific phospholipase C, X domain containing 2 ( MGI:3647874)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889
"Pseudo-wholemount" of euxassay_013296. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013296_01 euxassay_013296_02 euxassay_013296_03 euxassay_013296_04
EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889
euxassay_013296_05 euxassay_013296_06 euxassay_013296_07 euxassay_013296_08 euxassay_013296_09
EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889
euxassay_013296_10 euxassay_013296_11 euxassay_013296_12 euxassay_013296_13 euxassay_013296_14
EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889 EMAGE:15889
euxassay_013296_15 euxassay_013296_16 euxassay_013296_17 euxassay_013296_18 euxassay_013296_19
EMAGE:15889
euxassay_013296_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15889Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15889_wholemount_strong.wlz
15889_wholemount_moderate.wlz
15889_wholemount_weak.wlz
15889_wholemount_possible.wlz
15889_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15889_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 19
interdigital region between hindlimb digits 2 and 3
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 20
interdigital region between hindlimb digits 3 and 4
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 20
interdigital region between hindlimb digits 4 and 5
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 20
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 18 19
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 15
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 13 14 15
pons mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 15 16
midbrain mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 13 14 15
facial vii ganglion
strong strong
regionalstrong expression: see section 04 17 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 15
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 15 16 18 moderate expression: see section 19
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 15
spinal cord mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 14 weak expression: see section 07 08 09 10 11 12 13
neural retina
weak weak
regionalweak expression: see section 02 03 04 20
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39946
Entity Detected:Plcxd2, phosphatidylinositol-specific phospholipase C, X domain containing 2 ( MGI:3647874)
Sequence:sense strand is shown

>T39946
GACTCACTTGTAGGCAGTCACGGGGAAGTGAGGAAGGAAAAGAAGGCCCTCTCTTTCCTCACATAGCTAC
TTGGACTTAAAAAAAAATCTAAGGGGTTTCCATGCATTTTCCCCCAAAGACACTTTTACAAACTTAAGTC
TAAGAGAAGAATGCATGTTTCCTATGGTTAACATCAGGATCTCCCCAGTGGCTTGTGGTGGCAAATGGAA
GATGGAAGCATCCTTTTCAGGTTCTGTGGGCTATGCAACATCCTAACTGGCCCAGCTTCCTCTTGTCTTC
TGTGGTCATTTGAGCCTGTGTGAAGACTAAGTCAGAAAGGCATTCCTGGTCAGAAGAATGGCACATGTGA
GCGTGGACCATCCTGAGAGCTCTCTGCCATCAACCCAGAGCTCTAAGGGGCTCCTATGGAGCCAAGAACC
AGGTCTCTCATGAACTGTACAGTATCACCACTTTCTACGAGAGCAAGATATGTTTATTATCACAGTGCTC
AGCCACAGGCTGGCTCTGCATATCTTGGGCTAGAAGTGGGCACCTTTATTCTTCATATAAGCAGTGCACC
CTACCCTTGGCATCAGAAAAAGTATTTTCTTATTTTAATGTATTTTGGGCCCTATCTTTAAAATGATAGG
GACAGTAGTTGGAAAGTCTTTTCTGTGAGGGCCCAATACAGACTAAACATGCATGTTGGTTGCATGCCAG
AGTTCTTTGATTTCGTTCTGTATCCTTCTCCCCAAACGACTATCAGGCAAGTACCTGGATCATTTTGGCC
AAGTCCTCTGGAGTGAGGTCTTCAAGCCTGAGAGCAGAATCCTGTCTTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 111002. Forward Primer - name:111002_F_cDNA_LOC433022, sequence:GACTCACTTGTAGGCAGTCACG; Reverse Primer - name:111002_N_SP6_cDNA_LOC433022, sequence:TAAGACAGGATTCTGCTCTCAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15892 same embryo
 EMAGE:15890 same embryo
 EMAGE:15893 same embryo
 EMAGE:15894 same embryo
 EMAGE:15891 same embryo
 EurExpress:euxassay_013296 same experiment
 MGI:4827258 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS