Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15980

5031439G07Rik RIKEN cDNA 5031439G07 gene ( MGI:2444899)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980
"Pseudo-wholemount" of euxassay_013414. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013414_01 euxassay_013414_02 euxassay_013414_03 euxassay_013414_04
EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980
euxassay_013414_05 euxassay_013414_06 euxassay_013414_07 euxassay_013414_08 euxassay_013414_09
EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980
euxassay_013414_10 euxassay_013414_11 euxassay_013414_12 euxassay_013414_13 euxassay_013414_14
EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980 EMAGE:15980
euxassay_013414_15 euxassay_013414_16 euxassay_013414_17 euxassay_013414_18 euxassay_013414_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15980Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15980_wholemount_strong.wlz
15980_wholemount_moderate.wlz
15980_wholemount_weak.wlz
15980_wholemount_possible.wlz
15980_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15980_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 07 11 12
facial vii ganglion
weak weak
regionalweak expression: see section 02 03 15 16
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 14 15 16 17
vagus x ganglion
weak weak
regionalweak expression: see section 05 13
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 13
trigeminal v nerve
weak weak
regionalweak expression: see section 08 14
ventral grey horn
moderate moderate
regionalmoderate expression: see section 06 07 10 weak expression: see section 08 09
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 06 11
cervical ganglion
weak weak
regionalweak expression: see section 06 12
thoracic ganglion
weak weak
regionalweak expression: see section 08 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 04 06 07 11 12
neural retina
weak weak
regionalweak expression: see section 01 02 03 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45233
Entity Detected:5031439G07Rik, RIKEN cDNA 5031439G07 gene ( MGI:2444899)
Sequence:sense strand is shown

>T45233
GTTTGTCAGCTGGGAATACCTCGCCCTATGCCCAGCTCCAGAATGGGTCTCAACCCCCAGCTGGGCAGAC
AGTCCCCGATCCCCCAGAATGGCCTTTGCTTCCATCCAAAGAACACCGCCAACACACACACCTCCGACCC
CGAGACGTCCTGCGTTGATCTCGGCTCTCCGGAGGGACGCAGAATTCGGTTCTGAAGGAAAGTGGGAGGG
TACTTCTGCTGAGGGATGTCTGATGGGGACCCGGGTGGAACCCTCTCGGGAAGGTTGTAGGCAGAACCAC
CCTGGGGCCAGAGCTTAGAGCGAGGCTGGTGCTGTCCCCTTTGCCCCGTGCTTTGGTCAGCATGCTGGTC
TTGTCTTCAGCCTGGCTTTCTAGGCAGAGAGGAGACCAGGCTTCTTATGAGTCTGCATTGTCCTCAGTGG
GTGCAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 209697. Forward Primer - name:209697_F_exon_5031439G07Rik, sequence:GTTTGTCAGCTGGGAATACCTC; Reverse Primer - name:209697_N_SP6_exon_5031439G07Rik, sequence:CTTGCACCCACTGAGGACAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15979 same embryo
 EMAGE:15983 same embryo
 EMAGE:15981 same embryo
 EMAGE:15982 same embryo
 EurExpress:euxassay_013414 same experiment
 MGI:4822755 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS