Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16022

Fat1 FAT tumor suppressor homolog 1 (Drosophila) ( MGI:109168)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022
"Pseudo-wholemount" of euxassay_013462. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013462_01 euxassay_013462_02 euxassay_013462_03 euxassay_013462_04
EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022
euxassay_013462_05 euxassay_013462_06 euxassay_013462_07 euxassay_013462_08 euxassay_013462_09
EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022
euxassay_013462_10 euxassay_013462_11 euxassay_013462_12 euxassay_013462_13 euxassay_013462_14
EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022
euxassay_013462_15 euxassay_013462_16 euxassay_013462_17 euxassay_013462_18 euxassay_013462_19
EMAGE:16022 EMAGE:16022 EMAGE:16022 EMAGE:16022
euxassay_013462_20 euxassay_013462_21 euxassay_013462_22 euxassay_013462_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16022Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16022_wholemount_strong.wlz
16022_wholemount_moderate.wlz
16022_wholemount_weak.wlz
16022_wholemount_possible.wlz
16022_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16022_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
weak weak
regionalweak expression: see section 06 07
foot mesenchyme
weak weak
regionalweak expression: see section 07 22 23
lower leg rest of mesenchyme
weak weak
regionalweak expression: see section 03
upper leg rest of mesenchyme
weak weak
regionalweak expression: see section 01 02 03
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 17 18 19
vibrissa
weak weak
regionalweak expression: see section 03 04 06 19 20
mandible
weak weak
regionalweak expression: see section 06 07 08 09 17 18 19 20 21
maxilla
weak weak
regionalweak expression: see section 06 07 08 09 17 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 03 05 07 13 14 weak expression: see section 04 06 08 09 10 15 16 17 18 19 20 21 22 23
axial skeleton
weak weak
regionalweak expression: see section 11 12 13 14 15
sternum
weak weak
regionalweak expression: see section 14 15
axial skeleton tail region
weak weak
regionalweak expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45072
Entity Detected:Fat1, FAT tumor suppressor homolog 1 (Drosophila) ( MGI:109168)
Sequence:sense strand is shown

>T45072
TGTTCTACAGTATCACGGACGGAGACCCTTTTAGTCAGTTTACTATTAACTTCAACACTGGGGTGGTAAA
CGTCATAGCACCACTGGATTTTGAGTCCCACCCAGCCTATAAGCTAAGCGTGCGGGCAACTGACTCCCTG
ACGGGCGCTCACGCTGAAGTGTTTGTTGACATCATAGTGGAAGACATCAATGATAACCCTCCTGTGTTTG
TGCAGCCATCTTACTCCACAACCCTGTCTGAAGCATCTGTAATTGGAACACCTGTCCTTCAAGTTCGAGC
CACAGATTCCGACTCGGAACCAAACAGAGGAATTTCCTACCAGCTGATTGGAAATCACAGCAAAAGTCAC
GATCATTTTCACATAGATAGTAACACGGGGCTCATTTCACTAGTGAGAGCTTTGGATTACGAACAGTCCC
AGCAGCACAGGATCTTCGTAAGGGCTGTTGATGGAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 203417. Forward Primer - name:203417_F_exon_Fath, sequence:TGTTCTACAGTATCACGGACGG; Reverse Primer - name:203417_N_SP6_exon_Fath, sequence:CCCTCCATCAACAGCCCTTAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16021 same embryo
 EMAGE:16020 same embryo
 EMAGE:16019 same embryo
 EMAGE:16023 same embryo
 EurExpress:euxassay_013462 same experiment
 MGI:4824784 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS