Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16055

Agl amylo-1,6-glucosidase, 4-alpha-glucanotransferase ( MGI:1924809)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055
"Pseudo-wholemount" of euxassay_013482. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013482_01 euxassay_013482_02 euxassay_013482_03 euxassay_013482_04
EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055
euxassay_013482_05 euxassay_013482_06 euxassay_013482_07 euxassay_013482_08 euxassay_013482_09
EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055
euxassay_013482_10 euxassay_013482_11 euxassay_013482_12 euxassay_013482_13 euxassay_013482_14
EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055 EMAGE:16055
euxassay_013482_15 euxassay_013482_16 euxassay_013482_17 euxassay_013482_18 euxassay_013482_19
EMAGE:16055 EMAGE:16055
euxassay_013482_20 euxassay_013482_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16055Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16055_wholemount_strong.wlz
16055_wholemount_moderate.wlz
16055_wholemount_weak.wlz
16055_wholemount_possible.wlz
16055_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16055_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 14 15 16 17 18 19 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 04 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 16 17 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 08 09 12
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 14
tongue muscle
weak weak
regionalweak expression: see section 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45644
Entity Detected:Agl, amylo-1,6-glucosidase, 4-alpha-glucanotransferase ( MGI:1924809)
Sequence:sense strand is shown

>T45644
GAGCACAGAGCTTCAAAATGTGCTTTATTTTTAACAGATAAGTTATGTTTTTAATATAATAAATGCCAAC
TATACTTAACATAACCTATTTGTGTTAAAGAATAATTGGACATAATAAAACAGGCCACCAGGACATAAAG
CAATTCTGTTAAATTCCAGTTTCCCACTATGAGATAGTTTACATTTTCAAAATGGAAATTACTGGGCATA
TTTATGGAATTTTTCAAGGGGAAAAAAGCCTAGAGTCGTACCTTGATGACAGAGTGTTTGCTTAGCATGT
GTCAAGCCCTTCGTACTATCCCTAAAACCATCAAGAGAGAAAGAAGGGAGTGTGAGAGGGGAGGGAGGGG
GGAAAGAGAGGAAAGATTTAAAATAGCCATATTAGGTTATCTATAATGGGGTCACCATCCACCTCAGAAA
ATGGGCAGTGCTCCTACTGAGGGCTATCAATGAAAGACCTGTGCTGTGCTGTGCTTTGCACTGTCTATTT
GAAAGTCTCAGAAGGTATGGTTTACCTTATCCCAGCCACTGTAATTA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 200007. Forward Primer - name:200007_F_exon_Agl, sequence:GAGCACAGAGCTTCAAAATGTG; Reverse Primer - name:200007_N_SP6_exon_Agl, sequence:TAATTACAGTGGCTGGGATAAGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16056 same embryo
 EMAGE:16057 same embryo
 EMAGE:16058 same embryo
 EMAGE:16060 same embryo
 EMAGE:16059 same embryo
 EurExpress:euxassay_013482 same experiment
 MGI:4823029 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS