Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16078

Dab2ip disabled homolog 2 (Drosophila) interacting protein ( MGI:1916851)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078
"Pseudo-wholemount" of euxassay_013508. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013508_01 euxassay_013508_02 euxassay_013508_03 euxassay_013508_04
EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078
euxassay_013508_05 euxassay_013508_06 euxassay_013508_07 euxassay_013508_08 euxassay_013508_09
EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078
euxassay_013508_10 euxassay_013508_11 euxassay_013508_12 euxassay_013508_13 euxassay_013508_14
EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078 EMAGE:16078
euxassay_013508_15 euxassay_013508_16 euxassay_013508_17 euxassay_013508_18 euxassay_013508_19
EMAGE:16078 EMAGE:16078 EMAGE:16078
euxassay_013508_20 euxassay_013508_21 euxassay_013508_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16078Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16078_wholemount_strong.wlz
16078_wholemount_moderate.wlz
16078_wholemount_weak.wlz
16078_wholemount_possible.wlz
16078_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16078_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 16 17 18 19 20 21 22 moderate expression: see section 02 03 12 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 04 moderate expression: see section 03 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45546
Entity Detected:Dab2ip, disabled homolog 2 (Drosophila) interacting protein ( MGI:1916851)
Sequence:sense strand is shown

>T45546
TTAGACTTGCTCCCTCTCCAAGACAGCAGCAGCCTGCACCAGGCCCCGTGTGCAGTCGCCTCTCCTCACC
CTCCCAGCCCCAGCCAAGGACCCAGGCACTGCAGGCAGGGAGGGGCATCCCCCACAGCTGGGGCTGGTTT
TCCCCAGCTCTAGGCTGTTCTGTAGCATATCTGTCCCTCCCCCCCCCCCCTTTGTGGGACAGAGAAGGGC
AGGAGCTTGGGTCTTTCTTGGGTCCCCATCTGTTCCCACACTCTAGATTCCAAGCCCTGGTTCTGAGTCA
CCTAGGGCAGGAGCTAGGCTTTGCCCAGGCAGCAGAATGGGGCTAGGCAAGCTGCACTTAATGCTCCTAG
AGTCCTCACTAGAAAGCGTGGACATCCTGAGGTGTGGCCTAGCTAGGCTGCGCCCTGTCCTCAGTCCACG
ATGGACAGGCAAGGGTAAAAGAACCCAGTTAGGCTGCAGACCAAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 225669. Forward Primer - name:225669_F_exon_Dab2ip, sequence:TTAGACTTGCTCCCTCTCCAAG; Reverse Primer - name:225669_N_SP6_exon_Dab2ip, sequence:ATTGGTCTGCAGCCTAACTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16074 same embryo
 EMAGE:16077 same embryo
 EMAGE:16073 same embryo
 EMAGE:16076 same embryo
 EMAGE:16075 same embryo
 EurExpress:euxassay_013508 same experiment
 MGI:4824218 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS