Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16105

Robo3 roundabout homolog 3 (Drosophila) ( MGI:1343102)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105
"Pseudo-wholemount" of euxassay_013562. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013562_01 euxassay_013562_02 euxassay_013562_03 euxassay_013562_04
EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105
euxassay_013562_05 euxassay_013562_06 euxassay_013562_07 euxassay_013562_08 euxassay_013562_09
EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105
euxassay_013562_10 euxassay_013562_11 euxassay_013562_12 euxassay_013562_13 euxassay_013562_14
EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105
euxassay_013562_15 euxassay_013562_16 euxassay_013562_17 euxassay_013562_18 euxassay_013562_19
EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105 EMAGE:16105
euxassay_013562_20 euxassay_013562_21 euxassay_013562_22 euxassay_013562_23 euxassay_013562_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16105Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16105_wholemount_strong.wlz
16105_wholemount_moderate.wlz
16105_wholemount_weak.wlz
16105_wholemount_possible.wlz
16105_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16105_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 13 15 16
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 08 09 11 12 13 14
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 06 07 15 16 17 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 06 07 08 09 14 15 16 17 18
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 19 20 21
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 15 16 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 07 08 09 17 18
spinal cord mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T45167
Entity Detected:Robo3, roundabout homolog 3 (Drosophila) ( MGI:1343102)
Sequence:sense strand is shown

>T45167
CTTGCAGAAGTCCCAATAGTCCCCAGCTTCCATTGGATTCATGCATCTGGTCAACATTGAAATTGTCTCT
TGTCTCTTTCATTCCCTCTAAGTAAAAGTTCTCAGAGTCTCCACAATCCCCCCCCCCCCCCTTCCAGGAC
TGAAGCCAAGGATGAGGAAAAAGTAGTGTCTGGGTGCTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 228017. Forward Primer - name:228017_F_exon_Robo3, sequence:CTTGCAGAAGTCCCAATAGTCC; Reverse Primer - name:228017_N_SP6_exon_Robo3, sequence:CAGAGCACCCAGACACTACTTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16103 same embryo
 EMAGE:16106 same embryo
 EMAGE:16107 same embryo
 EMAGE:16104 same embryo
 EMAGE:16108 same embryo
 EurExpress:euxassay_013562 same experiment
 MGI:4827786 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS