Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16297

Stra6 stimulated by retinoic acid gene 6 ( MGI:107742)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297
"Pseudo-wholemount" of euxassay_017150. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_017150_01 euxassay_017150_02 euxassay_017150_03 euxassay_017150_04
EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297
euxassay_017150_05 euxassay_017150_06 euxassay_017150_07 euxassay_017150_08 euxassay_017150_09
EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297
euxassay_017150_10 euxassay_017150_11 euxassay_017150_12 euxassay_017150_13 euxassay_017150_14
EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297
euxassay_017150_15 euxassay_017150_16 euxassay_017150_17 euxassay_017150_18 euxassay_017150_19
EMAGE:16297 EMAGE:16297 EMAGE:16297 EMAGE:16297
euxassay_017150_20 euxassay_017150_21 euxassay_017150_22 euxassay_017150_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16297Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16297_wholemount_strong.wlz
16297_wholemount_moderate.wlz
16297_wholemount_weak.wlz
16297_wholemount_possible.wlz
16297_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16297_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 02 03 04 05 15 16 17 18 weak expression: see section 19
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 02 05 06 07 19 20 21 22
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 weak expression: see section 13 14 15 16
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
dorsal grey horn
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12
ventral grey horn
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 12 13 14
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 12 13 14 15
nasal septum
weak weak
regionalweak expression: see section 12 14
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
metanephros
weak weak
regionalweak expression: see section 05 06 07 08 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63422
Entity Detected:Stra6, stimulated by retinoic acid gene 6 ( MGI:107742)
Sequence:sense strand is shown

>T63422
CACAGATGTCTCCTACCTGCTGGCTGGCTTTGGGATCGTGCTCTCTGAAGACAGGCAGGAGGTGGTAGAG
CTGGTGAAGCATCACCTATGGACTGTGGAAGCATGCTACATCTCAGCTCTGGTCTTGTCCTGCGCATCAA
CCTTCCTGCTCCTGATCCGATCCCTGAGGACACACAGGGCCAATCTTCAAGCACTACACCGAGGGGCTGC
CCTGGATCTGGACCCCCCTCTTCAGAGTATTCATCCCTCTCGCCAAGCCATAGTCAGCTGGATGAGCTTC
TGTGCCTACCAGACGGCCTTCAGCTGCCTTGGGCTCCTGGTGCAGCAGGTCATCTTCTTCTTGGGGACCA
CATCCCTGGCCTTCCTGGTGTTTGTGCCTTTACTGCATGGCAGGAACCTCCTGCTGCTGCGATCCCTGGA
ATCCACGTGGCCCTTCTGGCTGACTGTGGCCTTAGCTGTAATCCTGCAGAACATAGCAGCCAACTGGATC
TTCCTGAGGACTCACCATGGATACCCAGAGCTGACCAACCGGCGCATGCTCTGCGTAGCTACTTTTCTCC
TCTTCCCCATCAACATGCTGGTGGGAGCCATAATGGCTGTCTGGCGGGTGCTCATCTCTTCTCTCTACAA
CACTGTTCACCTCGGCCAGATGGACCTCAGCCTGCTGCCGCAGAGGGCAGCCTCCCTGGATCCAGGCTAC
CACACATACCAAAACTTCCTGAGGATTGAGGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74157. Forward Primer - name:074157_F_cDNA_Stra6, sequence:CACAGATGTCTCCTACCTGCTG; Reverse Primer - name:074157_N_SP6_cDNA_Stra6, sequence:GGCCTCAATCCTCAGGAAGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16294 same embryo
 EMAGE:16296 same embryo
 EMAGE:16295 same embryo
 EMAGE:16293 same embryo
 EMAGE:16292 same embryo
 EurExpress:euxassay_017150 same experiment
 MGI:4828513 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS