EMAGE mouse gene expression spatial database

EMAGE:16399

Mir30b microRNA 30b ( MGI:2676908)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_019121. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_019121_01	euxassay_019121_02	euxassay_019121_03	euxassay_019121_04

euxassay_019121_05	euxassay_019121_06	euxassay_019121_07	euxassay_019121_08	euxassay_019121_09

euxassay_019121_10	euxassay_019121_11	euxassay_019121_12	euxassay_019121_13	euxassay_019121_14

euxassay_019121_15	euxassay_019121_16	euxassay_019121_17	euxassay_019121_18	euxassay_019121_19

euxassay_019121_20	euxassay_019121_21	euxassay_019121_22	euxassay_019121_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T70390
Entity Detected:	Mir30b, microRNA 30b ( MGI:2676908)
Sequence:	sense strand is shown >T70390 TGTAAACATCCTACACTCAGCT
Notes:	The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-30b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:	LNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:16400 same embryo
	EMAGE:16401 same embryo
	EMAGE:16402 same embryo
	EMAGE:16403 same embryo
	EurExpress:euxassay_019121 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source