Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16407

Mir19a microRNA 19a ( MGI:3618743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407
"Pseudo-wholemount" of euxassay_019076. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019076_01 euxassay_019076_02 euxassay_019076_03 euxassay_019076_04
EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407
euxassay_019076_05 euxassay_019076_06 euxassay_019076_07 euxassay_019076_08 euxassay_019076_09
EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407
euxassay_019076_10 euxassay_019076_11 euxassay_019076_12 euxassay_019076_13 euxassay_019076_14
EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407
euxassay_019076_15 euxassay_019076_16 euxassay_019076_17 euxassay_019076_18 euxassay_019076_19
EMAGE:16407 EMAGE:16407 EMAGE:16407 EMAGE:16407
euxassay_019076_20 euxassay_019076_21 euxassay_019076_22 euxassay_019076_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16407Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16407_wholemount_strong.wlz
16407_wholemount_moderate.wlz
16407_wholemount_weak.wlz
16407_wholemount_possible.wlz
16407_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16407_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 17 18 19 20 21 22 23 weak expression: see section 01 02 05 06 07 08 09 10 11 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70317
Entity Detected:Mir19a, microRNA 19a ( MGI:3618743)
Sequence:sense strand is shown

>T70317
TGTGCAAATCTATGCAAAACTGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-19a was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16405 same embryo
 EMAGE:16406 same embryo
 EMAGE:16408 same embryo
 EMAGE:16409 same embryo
 EMAGE:16404 same embryo
 EMAGE:16410 same embryo
 EurExpress:euxassay_019076 same experiment
 MGI:4826239 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS