Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16439

Mir501 microRNA 501 ( MGI:3629949)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439
"Pseudo-wholemount" of euxassay_019129. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019129_01 euxassay_019129_02 euxassay_019129_03 euxassay_019129_04
EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439
euxassay_019129_05 euxassay_019129_06 euxassay_019129_07 euxassay_019129_08 euxassay_019129_09
EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439
euxassay_019129_10 euxassay_019129_11 euxassay_019129_12 euxassay_019129_13 euxassay_019129_14
EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439 EMAGE:16439
euxassay_019129_15 euxassay_019129_16 euxassay_019129_17 euxassay_019129_18 euxassay_019129_19
EMAGE:16439 EMAGE:16439 EMAGE:16439
euxassay_019129_20 euxassay_019129_21 euxassay_019129_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16439Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16439_wholemount_strong.wlz
16439_wholemount_moderate.wlz
16439_wholemount_weak.wlz
16439_wholemount_possible.wlz
16439_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16439_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 18 19 20 21 22
humerus
weak weak
regionalweak expression: see section 01 02 03 04 22
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 03
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 03 22
fibula
weak weak
regionalweak expression: see section 01 02
tibia
weak weak
regionalweak expression: see section 01
femur
weak weak
regionalweak expression: see section 02 03 04 05 06 07 19 20 21 22
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 10 11 12 13 17 18 19 weak expression: see section 06 07 08 09 14 15 16 20 21
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
scapula
weak weak
regionalweak expression: see section 04 05 22
pelvic girdle skeleton
weak weak
regionalweak expression: see section 09 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70072
Entity Detected:Mir501, microRNA 501 ( MGI:3629949)
Sequence:sense strand is shown

>T70072
AATGCACCCGGGCAAGGATTTG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-501-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4826321 same experiment
 EurExpress:euxassay_019129 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS