Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16447

Mir125b-1 microRNA 125b-1 ( MGI:2676810)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447
euxassay_019103_01 euxassay_019103_02 euxassay_019103_03 euxassay_019103_04 euxassay_019103_05
EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447
euxassay_019103_06 euxassay_019103_07 euxassay_019103_08 euxassay_019103_09 euxassay_019103_10
EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447
euxassay_019103_11 euxassay_019103_12 euxassay_019103_13 euxassay_019103_14 euxassay_019103_15
EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447
euxassay_019103_16 euxassay_019103_17 euxassay_019103_18 euxassay_019103_19 euxassay_019103_20
EMAGE:16447 EMAGE:16447 EMAGE:16447 EMAGE:16447
euxassay_019103_21 euxassay_019103_22 euxassay_019103_23 euxassay_019103_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16447Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16447_wholemount_strong.wlz
16447_wholemount_moderate.wlz
16447_wholemount_weak.wlz
16447_wholemount_possible.wlz
16447_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16447_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70223
Entity Detected:Mir125b-1, microRNA 125b-1 ( MGI:2676810)
Sequence:sense strand is shown

>T70223
TCCCTGAGACCCTAACTTGTGA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-125b-5p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16448 same assay
 EMAGE:16445 same embryo
 EurExpress:euxassay_019103 same experiment
 EMAGE:16446 same embryo
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS