Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16468

Mir705 microRNA 705 ( MGI:3629673)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468
euxassay_019148_01 euxassay_019148_02 euxassay_019148_03 euxassay_019148_04 euxassay_019148_05
EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468
euxassay_019148_06 euxassay_019148_07 euxassay_019148_08 euxassay_019148_09 euxassay_019148_10
EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468
euxassay_019148_11 euxassay_019148_12 euxassay_019148_13 euxassay_019148_14 euxassay_019148_15
EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468 EMAGE:16468
euxassay_019148_16 euxassay_019148_17 euxassay_019148_18 euxassay_019148_19 euxassay_019148_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16468Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16468_wholemount_strong.wlz
16468_wholemount_moderate.wlz
16468_wholemount_weak.wlz
16468_wholemount_possible.wlz
16468_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16468_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70155
Entity Detected:Mir705, microRNA 705 ( MGI:3629673)
Sequence:sense strand is shown

>T70155
GGTGGGAGGTGGGGTGGGCA
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-705 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16467 same embryo
 EMAGE:16469 same embryo
 EurExpress:euxassay_019148 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS