Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16470

Mir714 microRNA 714 ( MGI:3718559)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470
euxassay_019152_01 euxassay_019152_02 euxassay_019152_03 euxassay_019152_04 euxassay_019152_05
EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470
euxassay_019152_06 euxassay_019152_07 euxassay_019152_08 euxassay_019152_09 euxassay_019152_10
EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470
euxassay_019152_11 euxassay_019152_12 euxassay_019152_13 euxassay_019152_14 euxassay_019152_15
EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470 EMAGE:16470
euxassay_019152_16 euxassay_019152_17 euxassay_019152_18 euxassay_019152_19 euxassay_019152_20
EMAGE:16470 EMAGE:16470 EMAGE:16470
euxassay_019152_21 euxassay_019152_22 euxassay_019152_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16470Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16470_wholemount_strong.wlz
16470_wholemount_moderate.wlz
16470_wholemount_weak.wlz
16470_wholemount_possible.wlz
16470_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16470_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70164
Entity Detected:Mir714, microRNA 714 ( MGI:3718559)
Sequence:sense strand is shown

>T70164
CGACGAGGGCCGGTCGGTCGC
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-714 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16472 same embryo
 EMAGE:16473 same embryo
 EMAGE:16471 same embryo
 EurExpress:euxassay_019152 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS