Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16645

Pds5b PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) ( MGI:2140945)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645
"Pseudo-wholemount" of euxassay_016843. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016843_01 euxassay_016843_02 euxassay_016843_03 euxassay_016843_04
EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645
euxassay_016843_05 euxassay_016843_06 euxassay_016843_07 euxassay_016843_08 euxassay_016843_09
EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645
euxassay_016843_10 euxassay_016843_11 euxassay_016843_12 euxassay_016843_13 euxassay_016843_14
EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645
euxassay_016843_15 euxassay_016843_16 euxassay_016843_17 euxassay_016843_18 euxassay_016843_19
EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645 EMAGE:16645
euxassay_016843_20 euxassay_016843_21 euxassay_016843_22 euxassay_016843_23 euxassay_016843_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16645Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16645_wholemount_strong.wlz
16645_wholemount_moderate.wlz
16645_wholemount_weak.wlz
16645_wholemount_possible.wlz
16645_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16645_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63569
Entity Detected:Pds5b, PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) ( MGI:2140945)
Sequence:sense strand is shown

>T63569
GGTTTGTGGTCACACGTATCAGCCATCCACACAGTGATAACACTGACTCCAGAGTCTTGTGAAAGTGTCC
TGTGTGATGGCTGTGTAGACACAAACTAAAGAAGACACATGTAAATAATCCCACTCCCCCATTTCTGACT
TCTAAAGTGCTTGTATAGCTTTTATCTGCGGCTTTAAACTGACAGGACCCAGCTGCTTACCGGATCTGTT
CATTTGAAAAGCATTTGCTAGGGTGGATCTTAAGCAGTACGTAGTCTGTCAGTGTTTGTATTTGAATTCT
CTGCAATTTTACTGTGAAAATTTGTTTTCAACAATTGGTGTCATTTTCTCAATGTCACTGTTTGTTGGAG
TTAAATGGTTTCTTCCTGCCCCTCTTTGTAGCTCATCTATGTTTACTCCAGGGCACTGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from genomic DNA prepared from tail-tips of two wild-type C57BL/6J mice), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 168053. Forward Primer - name:168053_F_Aprin, sequence:GGTTTGTGGTCACACGTATCAG; Reverse Primer - name:168053_R_SP6_Aprin, sequence:ACAGTGCCCTGGAGTAAACATA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16643 same embryo
 EMAGE:16646 same embryo
 EMAGE:16644 same embryo
 EMAGE:16648 same embryo
 EMAGE:16647 same embryo
 EurExpress:euxassay_016843 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS