Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16739

Mir487b microRNA 487b ( MGI:3619424)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739
"Pseudo-wholemount" of euxassay_019283. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019283_01 euxassay_019283_02 euxassay_019283_03 euxassay_019283_04
EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739
euxassay_019283_05 euxassay_019283_06 euxassay_019283_07 euxassay_019283_08 euxassay_019283_09
EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739
euxassay_019283_10 euxassay_019283_11 euxassay_019283_12 euxassay_019283_13 euxassay_019283_14
EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739
euxassay_019283_15 euxassay_019283_16 euxassay_019283_17 euxassay_019283_18 euxassay_019283_19
EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739 EMAGE:16739
euxassay_019283_20 euxassay_019283_21 euxassay_019283_22 euxassay_019283_23 euxassay_019283_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16739Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16739_wholemount_strong.wlz
16739_wholemount_moderate.wlz
16739_wholemount_weak.wlz
16739_wholemount_possible.wlz
16739_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16739_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70060
Entity Detected:Mir487b, microRNA 487b ( MGI:3619424)
Sequence:sense strand is shown

>T70060
AATCGTACAGGGTCATCCACTT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-487b was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16738 same embryo
 EMAGE:16735 same embryo
 EMAGE:16737 same embryo
 EMAGE:16736 same embryo
 EurExpress:euxassay_019283 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS