Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16740

Mir505 microRNA 505 ( MGI:3629955)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740
"Pseudo-wholemount" of euxassay_019292. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019292_01 euxassay_019292_02 euxassay_019292_03 euxassay_019292_04
EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740
euxassay_019292_05 euxassay_019292_06 euxassay_019292_07 euxassay_019292_08 euxassay_019292_09
EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740
euxassay_019292_10 euxassay_019292_11 euxassay_019292_12 euxassay_019292_13 euxassay_019292_14
EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740
euxassay_019292_15 euxassay_019292_16 euxassay_019292_17 euxassay_019292_18 euxassay_019292_19
EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740 EMAGE:16740
euxassay_019292_20 euxassay_019292_21 euxassay_019292_22 euxassay_019292_23 euxassay_019292_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16740Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16740_wholemount_strong.wlz
16740_wholemount_moderate.wlz
16740_wholemount_weak.wlz
16740_wholemount_possible.wlz
16740_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16740_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
humerus
weak weak
regionalweak expression: see section 01 02 03 21 22 23 24
fibula
weak weak
regionalweak expression: see section 02 03 04
tibia
weak weak
regionalweak expression: see section 04
femur
weak weak
regionalweak expression: see section 04 05 06 09 10 24
meckel's cartilage
weak weak
regionalweak expression: see section 06 07 08 09 10 16 17 18 19
axial skeleton
weak weak
regionalweak expression: see section 10 13 14 15 16 17
basioccipital bone
weak weak
regionalweak expression: see section 09 10
exoccipital bone
weak weak
regionalweak expression: see section 01
temporal bone
weak weak
regionalweak expression: see section 01 02 22 23 24
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 10 20 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
scapula
weak weak
regionalweak expression: see section 02 03 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70076
Entity Detected:Mir505, microRNA 505 ( MGI:3629955)
Sequence:sense strand is shown

>T70076
CGTCAACACTTGCTGGTTTTCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-505 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16741 same embryo
 EMAGE:16742 same embryo
 EurExpress:euxassay_019292 same experiment
 MGI:4826325 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS