Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16761

Mir138-2 microRNA 138-2 ( MGI:3618733)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761
"Pseudo-wholemount" of euxassay_019316. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019316_01 euxassay_019316_02 euxassay_019316_03 euxassay_019316_04
EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761
euxassay_019316_05 euxassay_019316_06 euxassay_019316_07 euxassay_019316_08 euxassay_019316_09
EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761
euxassay_019316_10 euxassay_019316_11 euxassay_019316_12 euxassay_019316_13 euxassay_019316_14
EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761 EMAGE:16761
euxassay_019316_15 euxassay_019316_16 euxassay_019316_17 euxassay_019316_18 euxassay_019316_19
EMAGE:16761 EMAGE:16761
euxassay_019316_20 euxassay_019316_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16761Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16761_wholemount_strong.wlz
16761_wholemount_moderate.wlz
16761_wholemount_weak.wlz
16761_wholemount_possible.wlz
16761_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16761_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 08 16 weak expression: see section 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 15 16 weak expression: see section 04 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09
ventral grey horn
weak weak
regionalweak expression: see section 10 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 08 09 10 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70265
Entity Detected:Mir138-2, microRNA 138-2 ( MGI:3618733)
Sequence:sense strand is shown

>T70265
AGCTGGTGTTGTGAATCAGGCCG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-138 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16762 same assay
 EMAGE:16764 same embryo
 EurExpress:euxassay_019316 same experiment
 MGI:4826214 same experiment
 MGI:4826213 same experiment
 EMAGE:16763 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS