Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16768

Mir139 microRNA 139 ( MGI:2676824)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768
euxassay_019361_01 euxassay_019361_02 euxassay_019361_03 euxassay_019361_04 euxassay_019361_05
EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768
euxassay_019361_06 euxassay_019361_07 euxassay_019361_08 euxassay_019361_09 euxassay_019361_10
EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768
euxassay_019361_11 euxassay_019361_12 euxassay_019361_13 euxassay_019361_14 euxassay_019361_15
EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768
euxassay_019361_16 euxassay_019361_17 euxassay_019361_18 euxassay_019361_19 euxassay_019361_20
EMAGE:16768 EMAGE:16768 EMAGE:16768 EMAGE:16768
euxassay_019361_21 euxassay_019361_22 euxassay_019361_23 euxassay_019361_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16768Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16768_wholemount_strong.wlz
16768_wholemount_moderate.wlz
16768_wholemount_weak.wlz
16768_wholemount_possible.wlz
16768_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16768_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70266
Entity Detected:Mir139, microRNA 139 ( MGI:2676824)
Sequence:sense strand is shown

>T70266
TGGAGACGCGGCCCTGTTGGAG
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-139-3p was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16770 same embryo
 EMAGE:16771 same embryo
 EMAGE:16769 same embryo
 EurExpress:euxassay_019361 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS