Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16806

Tnnc2 troponin C2, fast ( MGI:98780)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806
"Pseudo-wholemount" of euxassay_008629. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008629_01 euxassay_008629_02 euxassay_008629_03 euxassay_008629_04
EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806
euxassay_008629_05 euxassay_008629_06 euxassay_008629_07 euxassay_008629_08 euxassay_008629_09
EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806
euxassay_008629_10 euxassay_008629_11 euxassay_008629_12 euxassay_008629_13 euxassay_008629_14
EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806
euxassay_008629_15 euxassay_008629_16 euxassay_008629_17 euxassay_008629_18 euxassay_008629_19
EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806 EMAGE:16806
euxassay_008629_20 euxassay_008629_21 euxassay_008629_22 euxassay_008629_23 euxassay_008629_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16806Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16806_wholemount_strong.wlz
16806_wholemount_moderate.wlz
16806_wholemount_weak.wlz
16806_wholemount_possible.wlz
16806_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16806_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 20 21 22 23 24
upper leg muscle
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 18 19 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 23 24
hand
strong strong
regionalstrong expression: see section 03 04 05 06 07 23 24
foot
strong strong
regionalstrong expression: see section 06 07 08 09 10 17 18 19 20 21
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 21 22 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
eye skeletal muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21 22 23 24
tongue muscle
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1308
Entity Detected:Tnnc2, troponin C2, fast ( MGI:98780)
Sequence:sense strand is shown

>T1308
TCTCGAGCCTAGCTCGAGTCGGCCTTGTTGGCCTACTGGAGATCTGGGGCACCCTTGGGTGGTGGAGTGC
GGAGGAGACAACCCACAGCGGAGGAGTCCCAGTCGCCAGCAACCATGACGGACCAACAGGCTGAGGCCAG
GTCCTACCTCAGCGAGGAGATGATCGCTGAGTTCAAGGCTGCCTTTGACATGTTCGATGCTGATGGCGGT
GGGGACATCAGCGTTAAAGAGTTGGGCACCGTGATGAGGATGCTAGGGCAGACACCCACCAAAGAGGAAT
TGGATGCCATCATCGAGGAGGTGGACGAGGATGGCAGCGGTACTATCGACTTTGAAGAGTTCTTGGTCAT
GATGGTGCGCCAGATGAAAGAGGATGCGAAGGGGAAGAGCGAAGAGGAACTGGCTGAGTGCTTCCGCATC
TTTGACAGGAACGCAGACGGCTACATTGATGCTGAGGAGCTAGCTGAGATTTTCCGGGCTTCTGGGGAGC
ATGTGACAGAAGAGGAGATCGAATCCCTGATGAAGGATGGTGATAAAAACAACGACGGCCGCATTGACTT
TGATGAGTTTCTGAAGATGA
Notes:The probe template was PCR amplified from IMAGE:2259086 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2259086 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:BL6/SV129
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16804 same embryo
 EMAGE:16807 same embryo
 EMAGE:16803 same embryo
 EMAGE:16805 same embryo
 EurExpress:euxassay_008629 same experiment
 MGI:4828857 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS