Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:16891

Plod2 procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 ( MGI:1347007)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891
"Pseudo-wholemount" of euxassay_008722. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008722_01 euxassay_008722_02 euxassay_008722_03 euxassay_008722_04
EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891
euxassay_008722_05 euxassay_008722_06 euxassay_008722_07 euxassay_008722_08 euxassay_008722_09
EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891
euxassay_008722_10 euxassay_008722_11 euxassay_008722_12 euxassay_008722_13 euxassay_008722_14
EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891 EMAGE:16891
euxassay_008722_15 euxassay_008722_16 euxassay_008722_17 euxassay_008722_18 euxassay_008722_19
EMAGE:16891
euxassay_008722_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:16891Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
16891_wholemount_strong.wlz
16891_wholemount_moderate.wlz
16891_wholemount_weak.wlz
16891_wholemount_possible.wlz
16891_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:16891_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 14 15 16 17 18 moderate expression: see section 01 02 03 04 05 06 07 08 09 19 20
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 17 18 19
otic capsule
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 08 17
nasal septum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 13 14
trachea
weak weak
regionalweak expression: see section 11 12
axial skeleton
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 moderate expression: see section 07 08
basisphenoid bone
strong strong
regionalstrong expression: see section 01
exoccipital bone
strong strong
regionalstrong expression: see section 01 05 06 07 08 16 18 19 20 moderate expression: see section 02 03 04 15 17
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 20 moderate expression: see section 02 03
viscerocranium
strong strong
regionalExpression in the turbinate bone.
clavicle
strong strong
regionalstrong expression: see section 06 07 08 14 15
sternum
strong strong
regionalstrong expression: see section 10 11 12 13
axial skeleton tail region
strong strong
regionalstrong expression: see section 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2869
Entity Detected:Plod2, procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 ( MGI:1347007)
Sequence:sense strand is shown

>T2869
GGCCTCGAGGCCAGATTCGGCACGAGGCTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTA
TAGATCCCTAAGTTATTTACGTAACTCAAACTGAATGGCTCTCTGAGATGGATGACTGGCGTGAACATGT
CTCTGAAGTTGTACTTGAGAAGACAAGAAGAATAATGTCAACAGAACAACATCACTTTGGGCCAAGCATT
TGAACACTTTTTATATAAAATTGTGTGATGTCTCTTTATGTCTGCTCTGAGCCTTAAAACACAGGTTGAA
GAAGAAAAGAAAGGAAAAAAAAGTGAAAGTTGGTATTTATTTCTGTGCTTTAATTGTCTCTGAAAATAAT
GACAGTTTATAAAATGTTTAGGTACAAAGGCATAAATGATAATAAGTAAGCCTGGTAATATGTTCTTATT
TAAGAAGAACCTGAGAAGGTTTTATTTATCGGTGGGGGAAGTATAGCAAACGGTTCTAAATGAAAATCAG
CAAACCTGAAAGCCTGGGATTCTGACGCCTACTGGCTCTATGTAATTATTAAGTCACATTGACCTCTGTG
TAGG
Notes:The probe template was PCR amplified from IMAGE:1529771 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1529771 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:16894 same embryo
 EMAGE:16890 same embryo
 EMAGE:16892 same embryo
 EMAGE:16893 same embryo
 EurExpress:euxassay_008722 same experiment
 MGI:4827280 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS