Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17551

Anxa3 annexin A3 ( MGI:1201378)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551
"Pseudo-wholemount" of euxassay_005881. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005881_01 euxassay_005881_02 euxassay_005881_03 euxassay_005881_04
EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551
euxassay_005881_05 euxassay_005881_06 euxassay_005881_07 euxassay_005881_08 euxassay_005881_09
EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551
euxassay_005881_10 euxassay_005881_11 euxassay_005881_12 euxassay_005881_13 euxassay_005881_14
EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551
euxassay_005881_15 euxassay_005881_16 euxassay_005881_17 euxassay_005881_18 euxassay_005881_19
EMAGE:17551 EMAGE:17551 EMAGE:17551 EMAGE:17551
euxassay_005881_20 euxassay_005881_21 euxassay_005881_22 euxassay_005881_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17551Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17551_wholemount_strong.wlz
17551_wholemount_moderate.wlz
17551_wholemount_weak.wlz
17551_wholemount_possible.wlz
17551_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17551_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
interdigital region between hindlimb digits 1 and 2
weak weak
regionalweak expression: see section 08 09 22
interdigital region between hindlimb digits 2 and 3
weak weak
regionalweak expression: see section 08 09 21 22
interdigital region between hindlimb digits 3 and 4
weak weak
regionalweak expression: see section 08 09 22
interdigital region between hindlimb digits 4 and 5
weak weak
regionalweak expression: see section 08 09 21
diencephalon meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
rectum
moderate moderate
regionalmoderate expression: see section 12
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 07 09 10 12 13 14 15 16 17 18 19
nucleus pulposus
weak weak
regionalweak expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2913
Entity Detected:Anxa3, annexin A3 ( MGI:1201378)
Sequence:sense strand is shown

>T2913
GGCCTCGAGGCCAGATTCGGCACGAGGATCTCGCAGGCCTATTATACAGTGTATAAGAAGAGCCTCGGGG
ATGACATTAGCTCTGAGACGTCTGGAGACTTCCGGAAAGCTCTGCTGACTCTGGCAGATGGTAGAAGAGA
TGAAAGCCTCAAAGTGGATGAACATCTGGCCAAAAAGGATGCTCAGGTAGATCCTCTATAATGCTGGTGA
GAACAAATGGGGCACAGACGAAGACAAATTCACCGAGGTCTTGTGTCTACGGAGCTTCCCGCAGCTGAAA
CTAACATTTGATGAGTACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATTAAAGGAGAATTATCTG
GACATTTTGAAGACCTGCTGCTGGCCATAGTTCATTGTGCGAGGAACACTCCAGCGTTTTTGGCAGAAAG
ACTTCATCAGGCTTTGAAGGGTGCTGGAACAGATGAATTCACTCTGAACAGAATAATGGTTTCCAGATCA
GAGATTGATCTTTTGGACATCAGACATGAGTTCAAGAAGCACTATGGCTACTCTCTATACTCGGCCATCC
AATCAGATACTTCTGGAGACTACAGAACCG
Notes:The probe template was PCR amplified from IMAGE:1531374 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1531374 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17549 same embryo
 EMAGE:17547 same embryo
 EMAGE:17550 same embryo
 EMAGE:17548 same embryo
 EurExpress:euxassay_005881 same experiment
 MGI:4823152 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS