EMAGE mouse gene expression spatial database

EMAGE:17669

Cdca4 cell division cycle associated 4 ( MGI:1919213)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_005995. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_005995_01	euxassay_005995_02	euxassay_005995_03	euxassay_005995_04

euxassay_005995_05	euxassay_005995_06	euxassay_005995_07	euxassay_005995_08	euxassay_005995_09

euxassay_005995_10	euxassay_005995_11	euxassay_005995_12	euxassay_005995_13	euxassay_005995_14

euxassay_005995_15	euxassay_005995_16	euxassay_005995_17	euxassay_005995_18	euxassay_005995_19

euxassay_005995_20	euxassay_005995_21	euxassay_005995_22	euxassay_005995_23	euxassay_005995_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T194
Entity Detected:	Cdca4, cell division cycle associated 4 ( MGI:1919213)
Sequence:	sense strand is shown >T194 GCCATGGCGACCCTTTGTGGGCGCTGACCGATCCGGGTGCCCGAAGGAGTGGCGGGGTCTGCCTTGCGGC GCCGGACAGGATGTTTGCTAGAGGGCTGAAGAGGAAATATGGTGACCAGGAAGAAGGAGTAGAGGGTTTT GGCACTGTCCCTTCCTATAGCCTGCAGCGACAGTCACTCCTGGACATGTCCCTTGTCAAGCTCCAGCTCT GTCACATGCTAGTGGAGCCCAATCTCTGCCGCTCGGTCCTCATCGCCAACACAGTCCGGCAGATCCAGGA GGAAATGAGCCAGGATGGTGTGTGGCATGGGATGGCACCCCAGAATGTAGATCGGGCACCAGTTGAGCGC CTGGTGTCCACAGAGATCCTGTGTCGTACAGTGAGGGGAGCTGAGGAAGAGCACCCTGCTCCTGAACTGG AAGATGCTCCCTTGCAAAACTCGGTTTCCGAGCTCCCCATCGTTGGCTCAGCAC
Notes:	The probe template was PCR amplified from IMAGE:2648064 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2648064 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:17670 same embryo
	EMAGE:17668 same embryo
	EurExpress:euxassay_005995 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source