Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17688

Mxra8 matrix-remodelling associated 8 ( MGI:1922011)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688
"Pseudo-wholemount" of euxassay_006017. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006017_01 euxassay_006017_02 euxassay_006017_03 euxassay_006017_04
EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688
euxassay_006017_05 euxassay_006017_06 euxassay_006017_07 euxassay_006017_08 euxassay_006017_09
EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688
euxassay_006017_10 euxassay_006017_11 euxassay_006017_12 euxassay_006017_13 euxassay_006017_14
EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688 EMAGE:17688
euxassay_006017_15 euxassay_006017_16 euxassay_006017_17 euxassay_006017_18 euxassay_006017_19
EMAGE:17688
euxassay_006017_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17688Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17688_wholemount_strong.wlz
17688_wholemount_moderate.wlz
17688_wholemount_weak.wlz
17688_wholemount_possible.wlz
17688_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17688_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 14 15 16 17 18 19 20
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 13 14 weak expression: see section 04 15 16
4th ventricle
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 08 09 10 11 13 14 weak expression: see section 04 15 16 17
aortic valve
strong strong
regionalstrong expression: see section 11 12 not examined expression: see section 08 09
mitral valve
strong strong
regionalstrong expression: see section 08 09 not examined expression: see section 11 12
pulmonary valve
strong strong
regionalstrong expression: see section 11 12 not examined expression: see section 09
tricuspid valve
strong strong
regionalstrong expression: see section 11 12
mandible
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20
maxilla
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20
premaxilla
strong strong
regionalstrong expression: see section 09 10 11 14 15
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 19 20
clavicle
strong strong
regionalstrong expression: see section 06 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T288
Entity Detected:Mxra8, matrix-remodelling associated 8 ( MGI:1922011)
Sequence:sense strand is shown

>T288
GCCCAGACCCGGCCCAGGGCTCCGTGATGTCAGCGGGTGCTGGCAGGGAGAGGGGGTCGGCTGTTTTTCT
GGAGAGTTAGAGCTGAGTAAGACAAAGCACGTCCCCCGCAGGCGCCATGGAACTGCTGTCCCGTGTCCTG
CTGTGGAAACTGCTGCTTCTTCAGAGCTCTGCAGTCCTGTCCTCAGGGCCTTCAGGGACCGCAGCAGCCA
GCAACTCTCTGGTGTCTGAGTCTGTGGTGAGCTTGGCAGCCGGAACCCAGGCTGTGCTACGCTGCCAGAG
CCCCCGCATGGTGTGGACCCAAGACCGGCTGCATGATCGCCAGCGCGTGGTCCACTGGGACCTCAGCGGG
GGCCCGGGCAGCCAACGGCGCCGACTTGTGGATATGTATTCGGCGGGTGAACAGCGCGTGTACGAGCCGC
GCGATCGACCGCCTCCTGCTGTCGCCTTCTGCTTTCCACGACGGCAACTTCTCGCTGCTCATTCGCGCTG
TGGAGAGAGGCGATGAAGGGGTGTACACCT
Notes:The probe template was PCR amplified from IMAGE:2810909 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2810909 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17689 same embryo
 EMAGE:17690 same embryo
 EMAGE:17691 same embryo
 EurExpress:euxassay_006017 same experiment
 MGI:4826522 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS