Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17729

Fezf1 Fez family zinc finger 1 ( MGI:1920441)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729
"Pseudo-wholemount" of euxassay_008891. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008891_01 euxassay_008891_02 euxassay_008891_03 euxassay_008891_04
EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729
euxassay_008891_05 euxassay_008891_06 euxassay_008891_07 euxassay_008891_08 euxassay_008891_09
EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729
euxassay_008891_10 euxassay_008891_11 euxassay_008891_12 euxassay_008891_13 euxassay_008891_14
EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729 EMAGE:17729
euxassay_008891_15 euxassay_008891_16 euxassay_008891_17 euxassay_008891_18 euxassay_008891_19
EMAGE:17729 EMAGE:17729 EMAGE:17729
euxassay_008891_20 euxassay_008891_21 euxassay_008891_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17729Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17729_wholemount_strong.wlz
17729_wholemount_moderate.wlz
17729_wholemount_weak.wlz
17729_wholemount_possible.wlz
17729_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17729_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 07 08 09 17 18 19 20 21 22
anterior naris
strong strong
regionalstrong expression: see section 14 15 16 17 18 19
external naris
strong strong
regionalstrong expression: see section 14 15 19 20
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 13 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35391
Entity Detected:Fezf1, Fez family zinc finger 1 ( MGI:1920441)
Sequence:sense strand is shown

>T35391
GTTTTCACTTGTGAAGTCTGCGGCAAGGTCTTTAATGCGCACTATAACTTAACCCGTCACATGCCGGTAC
ACACAGGAGCCAGACCCTTCGTGTGTAAAGTGTGTGGGAAAGGTTTCCGGCAAGCTAGCACCCTTTGCCG
GCATAAGATCATTCACACACAGGAGAAACCTCACAAGTGCAACCAGTGCGGTAAAGCATTTAACAGAAGT
TCCACGTTAAACACACATACCCGAATTCACGCGGGCTACAAACCATTCGTGTGTGAATTCTGCGGCAAAG
GATTTCATCAAAAAGGGAATTACAAAAATCACAAGTTAACCCACAGCGGGGAGAAACAGTTCAAGTGCAA
TATCTGCAACAAGGCTTTCCACCAGGTGTACAACCTCACCTTCCACATGCACACTCACAACGACAAGAAG
CCTTTCACCTGCCCCACGTGTGGCAAGGGCTTTTGTAGGAACTTTGACCTCAAGAAGCACGTCCGCAAGC
TACACGACAGCAGCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79263. Forward Primer - name:079263_F_cDNA_3110069A13Rik, sequence:GTTTTCACTTGTGAAGTCTGCG; Reverse Primer - name:079263_N_SP6_cDNA_3110069A13Rik, sequence:CAGGCTGCTGTCGTGTAGCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17728 same embryo
 EurExpress:euxassay_008891 same experiment
 MGI:4824831 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS