Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17762

Gata6 GATA binding protein 6 ( MGI:107516)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762
"Pseudo-wholemount" of euxassay_008918. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008918_01 euxassay_008918_02 euxassay_008918_03 euxassay_008918_04
EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762
euxassay_008918_05 euxassay_008918_06 euxassay_008918_07 euxassay_008918_08 euxassay_008918_09
EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762
euxassay_008918_10 euxassay_008918_11 euxassay_008918_12 euxassay_008918_13 euxassay_008918_14
EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762
euxassay_008918_15 euxassay_008918_16 euxassay_008918_17 euxassay_008918_18 euxassay_008918_19
EMAGE:17762 EMAGE:17762 EMAGE:17762 EMAGE:17762
euxassay_008918_20 euxassay_008918_21 euxassay_008918_22 euxassay_008918_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17762Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17762_wholemount_strong.wlz
17762_wholemount_moderate.wlz
17762_wholemount_weak.wlz
17762_wholemount_possible.wlz
17762_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17762_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pericardium
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
pleura
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
adrenal medulla
moderate moderate
regionalmoderate expression: see section 06 07 08 14 15
aorta
moderate moderate
regionalmoderate expression: see section 10
heart valve
strong strong
regionalstrong expression: see section 10 11 moderate expression: see section 09 12 13
stomach
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11
midgut
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18
urinary system mesentery
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 15 16
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09
right lung
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35448
Entity Detected:Gata6, GATA binding protein 6 ( MGI:107516)
Sequence:sense strand is shown

>T35448
GTGGGAGAAACTGTGACAATGACCGGGGCCTTGTCTGCTAAGGAAGATTGAGAGATTTAAGAGAAAATGT
TTGTGTATTGCTCCAAATCATGTGCTTCTTGTGATCAACCTCGGTTATCCCAGAACCCATTCATCCCCGA
CCACCGTGCACATTTCACAAGCGTTCGTGGAGAGGAGCACTGGGAGCCATTTGGTCTATCCTGGAGGCGG
AGTGCATTCCTGGGGTCTCAACAAGAATATTAATTTGCAAGATTGCATCATGACAGACACTGACTGACTT
ATCTCAACGTTCATCGTAACGTGGCTGATCTGAGGTCACTTGGAATTTGTAAACAGGGTAGCAAACAAGA
TATTTTTCTTCCATGTACACAATAATTTTTTTAAGTGCAATTTGCGTTGCAGCAATCAGTGTTAAATCAT
TTGCATAAGATTTAACAGCATTTTTATAATGAATGTAAACATTTTAACTTAATGGTACTTAAAATAATTT
AAAAAAAAGTTAACTTTAGACATATGCTTCTTACACTCACAGCCCACTTCTGTGTTCCCAATTGTTTAAA
AGAAAAAAAAAAAGATTTCAAGAACAAATCTTCTCTCAGGAAATTGCCTTTTCTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96709. Forward Primer - name:096709_F_cDNA_Gata6, sequence:GTGGGAGAAACTGTGACAATGA; Reverse Primer - name:096709_N_SP6_cDNA_Gata6, sequence:GGAGAAAAGGCAATTTCCTGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17759 same embryo
 EMAGE:17758 same embryo
 EMAGE:17760 same embryo
 EMAGE:17757 same embryo
 EMAGE:17761 same embryo
 EurExpress:euxassay_008918 same experiment
 MGI:4825006 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS