Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17823

Col19a1 collagen, type XIX, alpha 1 ( MGI:1095415)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823
"Pseudo-wholemount" of euxassay_009024. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009024_01 euxassay_009024_02 euxassay_009024_03 euxassay_009024_04
EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823
euxassay_009024_05 euxassay_009024_06 euxassay_009024_07 euxassay_009024_08 euxassay_009024_09
EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823
euxassay_009024_10 euxassay_009024_11 euxassay_009024_12 euxassay_009024_13 euxassay_009024_14
EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823
euxassay_009024_15 euxassay_009024_16 euxassay_009024_17 euxassay_009024_18 euxassay_009024_19
EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823 EMAGE:17823
euxassay_009024_20 euxassay_009024_21 euxassay_009024_22 euxassay_009024_23 euxassay_009024_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17823Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17823_wholemount_strong.wlz
17823_wholemount_moderate.wlz
17823_wholemount_weak.wlz
17823_wholemount_possible.wlz
17823_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17823_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 05 06 19 20 21 22 moderate expression: see section 03 04 07 08 09 10 11 12 16 17 18 23
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 03
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 02
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 02 weak expression: see section 03
tarsus
weak weak
regionalweak expression: see section 03 04
fibula
weak weak
regionalweak expression: see section 02 03
tibia
weak weak
regionalweak expression: see section 03
otic capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 17 18 19 20 21 22
maxilla
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 17 18 19 20 21 22
basioccipital bone
strong strong
regionalstrong expression: see section 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 20 22
exoccipital bone
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 02 03 04 05 06 19 20 21 22
temporal bone petrous part
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 02 03 04 05 06 19 20 21 22
vault of skull
moderate moderate
regionalmoderate expression: see section 02
frontal bone primordium
strong strong
regionalstrong expression: see section 24
parietal bone
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 21 22
orbito-sphenoid
strong strong
regionalstrong expression: see section 23 24 moderate expression: see section 03 05 06 07 08 09 19 20 21 22
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 07 08 09 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36175
Entity Detected:Col19a1, collagen, type XIX, alpha 1 ( MGI:1095415)
Sequence:sense strand is shown

>T36175
GAGCAAAAGGTGACAAGGGTAGTGAGGGACCCCCTGGGAAACCTGGACCTCCTGGACCCCCTGGTGTCCC
GCTCAATGAGGGAAACGGCATGAGCAGTTTATATAAAATCCAGGGAGGGGTGAATGTTCCCGGTTACCCA
GGACCTCCGGGCCCCCCAGGTCCAAAAGGTGATCCTGGCCCAGTGGGAGAGCCTGGTGCAATGGGCTTGC
CAGGACTAGAAGGATTTCCTGGTGTAAAGGGAGATCGAGGCCCAGCAGGCCCCCCAGGCATAGCCGGTAT
ATCGGGAAAACCAGGTGCCCCAGGTCCTCCAGGAGTACCAGGGGAGCAGGGTGAAAGAGGACCTATTGGA
GATACAGGTTTTCCTGGACCAGAGGGACCCTCGGGGAAGCCAGGCATAAATGGAAAAGATGGATTACCAG
GTGCTCAGGGCATCATGGGTAAACCTGGTGACAGAGGCCCCAAAGGAGAACGCGGTGATCAGGGAATTCC
AGGAGACAGAGGCCCTCAAGGTGAACGTGGGAAGCCAGGTCTTACGGGCATGAAGGGGGCTATAGGCCCT
GTGGGACCAGCAGGAAGCAAGGGCTCCACTGGGCCACCTGGCCACCAAGGTCCTCCAGGCAATCCTGGCA
TCCCTGGCACTCCGGCTGATGCTGTTTCATTTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97564. Forward Primer - name:097564_F_cDNA_Col19a1, sequence:GAGCAAAAGGTGACAAGGGTAG; Reverse Primer - name:097564_N_SP6_cDNA_Col19a1, sequence:TCAAATGAAACAGCATCAGCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17825 same embryo
 EMAGE:17828 same embryo
 EMAGE:17824 same embryo
 EMAGE:17826 same embryo
 EMAGE:17827 same embryo
 EurExpress:euxassay_009024 same experiment
 MGI:4823983 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS