Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17827

Vash1 vasohibin 1 ( MGI:2442543)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827
"Pseudo-wholemount" of euxassay_009040. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009040_01 euxassay_009040_02 euxassay_009040_03 euxassay_009040_04
EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827
euxassay_009040_05 euxassay_009040_06 euxassay_009040_07 euxassay_009040_08 euxassay_009040_09
EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827
euxassay_009040_10 euxassay_009040_11 euxassay_009040_12 euxassay_009040_13 euxassay_009040_14
EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827
euxassay_009040_15 euxassay_009040_16 euxassay_009040_17 euxassay_009040_18 euxassay_009040_19
EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827 EMAGE:17827
euxassay_009040_20 euxassay_009040_21 euxassay_009040_22 euxassay_009040_23 euxassay_009040_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17827Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17827_wholemount_strong.wlz
17827_wholemount_moderate.wlz
17827_wholemount_weak.wlz
17827_wholemount_possible.wlz
17827_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17827_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 12 15 16 17 18 19 20 weak expression: see section 13 14 21 22 23 24
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36403
Entity Detected:Vash1, vasohibin 1 ( MGI:2442543)
Sequence:sense strand is shown

>T36403
GGAGGTGATTTATACAGGCTGCCAAGTTGGGGTGTGTTCTCTTTATCCTGTTTTCCAAACAAAACAAGGC
CTCTAAGGTCGACCCTGGGCAACCCACCTGGCCATCACTCCTGGTTGATGCTCTGAGTTACCAAATGGTA
TTTTATTGTACAGGAGCCACGCCCTGGTTTCTTAAAGGCGCCAGGCACTGTTTGACCATGTGTTATCTTT
ATAGCGGGTGTGTGGGAGGCCTTCTGTGAGGCACTTATTCCCCCCCCCCCCACCTCCTGATCATCGTCCC
ACCCCCGCTTGAGGATTTAGGGATGGCAGGGGGAAAGAAGGTGGTCCCAAGTGGCAGCAGCAGTGCCTCC
CCAAACGCAGCCGCCACCACCACTGCTGCTGCTGGCTGCTGCCGCTGCTGCCCCCCACTCTGGCACTAAA
CGTTTGGAGACCACCGAAGGGGCCTCAGCACAGAGAGATGAGGAACCCGAAGAGGAAGGGGAAGAGGACC
TACGAGATGGAGGTGTCCCTTTTTTCATCAACCGAGGTGGACTGCCAGTGGATGAGGCCACCTGGGAAAG
GATGTGGAAGCATGTGGCCAAGATCCACCCAGATGGAGAGAAGGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 70042. Forward Primer - name:070042_F_cDNA_G630009D10Rik, sequence:GGAGGTGATTTATACAGGCTGC; Reverse Primer - name:070042_N_SP6_cDNA_G630009D10Rik, sequence:CCACCTTCTCTCCATCTGGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17825 same embryo
 EMAGE:17828 same embryo
 EMAGE:17824 same embryo
 EMAGE:17823 same embryo
 EMAGE:17826 same embryo
 EurExpress:euxassay_009040 same experiment
 MGI:4829148 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS