Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17893

Il12rb2 interleukin 12 receptor, beta 2 ( MGI:1270861)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893
"Pseudo-wholemount" of euxassay_009595. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009595_01 euxassay_009595_02 euxassay_009595_03 euxassay_009595_04
EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893
euxassay_009595_05 euxassay_009595_06 euxassay_009595_07 euxassay_009595_08 euxassay_009595_09
EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893
euxassay_009595_10 euxassay_009595_11 euxassay_009595_12 euxassay_009595_13 euxassay_009595_14
EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893
euxassay_009595_15 euxassay_009595_16 euxassay_009595_18 euxassay_009595_19 euxassay_009595_20
EMAGE:17893 EMAGE:17893 EMAGE:17893 EMAGE:17893
euxassay_009595_21 euxassay_009595_22 euxassay_009595_23 euxassay_009595_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17893Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17893_wholemount_strong.wlz
17893_wholemount_moderate.wlz
17893_wholemount_weak.wlz
17893_wholemount_possible.wlz
17893_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17893_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 08 13 14
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
midbrain ventricular layer
strong strong
regionalstrong expression: see section 09
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 05 06 07 08 09 12 13 14
lower jaw incisor
strong strong
regionalstrong expression: see section 13 moderate expression: see section 09 10 14
upper jaw incisor
strong strong
regionalstrong expression: see section 13 moderate expression: see section 09 14
renal cortex
moderate moderate
regionalmoderate expression: see section 06 07 08 09 14 15 16 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36499
Entity Detected:Il12rb2, interleukin 12 receptor, beta 2 ( MGI:1270861)
Sequence:sense strand is shown

>T36499
TTCTGCACCCACTCACATTAACATAGTGGACCTATGTGGCACTGGGTTGCTGGCTCCTCACCAGGTCTCT
GCAAAGTCGGAGAACATGGACAACATTCTAGTGACCTGGCAGCCTCCTAAGAAAGCTGATTCTGCTGTTC
GGGAGTACATAGTGGAATGGAGAGCTCTCCAACCAGGGAGCATCACGAAGTTTCCCCCACACTGGCTGCG
GATCCCCCCGGACAACATGTCTGCTCTGATTTCAGAGAACATAAAGCCCTATATCTGTTATGAAATCAGG
GTGCATGCACTGTCAGAGAGCCAAGGAGGGTGCAGCTCCATCCGGGGTGACTCCAAGCACAAAGCACCAG
TGAGTGGCCCTCACATTACTGCCATCACAGAGAAAAAGGAACGCCTTTTCATTTCCTGGACCCACATTCC
ATTCCCGGAGCAAAGGGGCTGCATCCTCCATTACAGAATATACTGGAAAGAACGAGACTCGACAGCACAA
CCTGAGCTCTGCGAAATTCAGTACCGACGCTCTCAAAACTCACATCCAATAAGCAGCCTACAGCCCAGGG
TGACATATGTCCTATGGATGACAGCTGTGACAGCTGCTGGTGAAAGTCCCCAAGGAAATGAAAGGGAATT
TTGTCCACAGGGCAAAGCCAACTGGAAAGCATTCGTGATATCAAGCATTTGCATCGCTATCATCACG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97914. Forward Primer - name:097914_F_cDNA_Il12rb2, sequence:TTCTGCACCCACTCACATTAAC; Reverse Primer - name:097914_N_SP6_cDNA_Il12rb2, sequence:CGTGATGATAGCGATGCAAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17896 same embryo
 EMAGE:17895 same embryo
 EMAGE:17891 same embryo
 EMAGE:17894 same embryo
 EMAGE:17892 same embryo
 EurExpress:euxassay_009595 same experiment
 MGI:4825561 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS