Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17922

Synpo2l synaptopodin 2-like ( MGI:1916010)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922
"Pseudo-wholemount" of euxassay_011681. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011681_01 euxassay_011681_02 euxassay_011681_03 euxassay_011681_04
EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922
euxassay_011681_05 euxassay_011681_06 euxassay_011681_07 euxassay_011681_08 euxassay_011681_09
EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922
euxassay_011681_10 euxassay_011681_11 euxassay_011681_12 euxassay_011681_13 euxassay_011681_14
EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922
euxassay_011681_15 euxassay_011681_16 euxassay_011681_17 euxassay_011681_18 euxassay_011681_19
EMAGE:17922 EMAGE:17922 EMAGE:17922 EMAGE:17922
euxassay_011681_20 euxassay_011681_21 euxassay_011681_22 euxassay_011681_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17922Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17922_wholemount_strong.wlz
17922_wholemount_moderate.wlz
17922_wholemount_weak.wlz
17922_wholemount_possible.wlz
17922_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17922_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 18 19 20 21 22 23
upper leg muscle
strong strong
regionalstrong expression: see section 03 04 05 18 19 20 21 22 23
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 16 17 18 19 20 21 22 moderate expression: see section 08 15
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 21 22 23
hand mesenchyme
strong strong
regionalstrong expression: see section 03 04 05 22 23
foot mesenchyme
strong strong
regionalstrong expression: see section 04 05 19 20
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 03 04 22 23
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
heart ventricle
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
tongue muscle
strong strong
regionalstrong expression: see section 10 11 12 13 14 15
tail mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37107
Entity Detected:Synpo2l, synaptopodin 2-like ( MGI:1916010)
Sequence:sense strand is shown

>T37107
CAGAACCTGGATGAAAAACCTCGGGCGGGCGGTGCGGAATCTGGTCCGGAGGAGGACGCTTTAAGCCTCG
GGGCTGAAGCCTGTAACTTCATGCAGCCACTAGGGGGCAGGAGTTACAAGACCTTGCCTCAAGTATCACC
GAAAACCCCGCCTCCAATGGCTCCCAAAACTCCACCCCCTACAACGCCTAAGACTCCACCTCCCGTGGCT
CCTAAACCTGGGTCGCGAGGGCTCCTTGATGGGCTAGTGAATGGATCGACCCCGATGGTGGGAATCCCTG
AGCCGCCAAGGCTGCAAGGGAGGGGCGGGGAGCTATTTGCCAAACGGCAGAGCCGTGCCGATAGGTACGT
GGTGGAAGCTACATCTGGCTCTAGCCTTAATCCAGGCCTTCGCCCTAGAAGTCCTTCTCCCACACCCTCA
CTGCCCCCATCCTGGAAATACTCACCCAACATCCGTGCCCCACCTCCTATTGCTTACAACCCACTTCTCT
CACCCTTTTTTCCCCAAGCTGCCCGAACTCTCCCCAATAAGGCTCAATCCCAGGGGCCTCGGGTGACCCC
TAAGCAGGGTATCAAGGCCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 93564. Forward Primer - name:093564_F_cDNA_Synpo2l, sequence:CAGAACCTGGATGAAAAACCTC; Reverse Primer - name:093564_N_SP6_cDNA_Synpo2l, sequence:AGGGCCTTGATACCCTGCTTA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17920 same embryo
 EMAGE:17919 same embryo
 EMAGE:17923 same embryo
 EMAGE:17921 same embryo
 EMAGE:17918 same embryo
 EurExpress:euxassay_011681 same experiment
 MGI:4828561 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS