Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17925

Il17rd interleukin 17 receptor D ( MGI:2159727)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925
"Pseudo-wholemount" of euxassay_011690. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011690_01 euxassay_011690_02 euxassay_011690_03 euxassay_011690_04
EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925
euxassay_011690_05 euxassay_011690_06 euxassay_011690_07 euxassay_011690_08 euxassay_011690_09
EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925
euxassay_011690_10 euxassay_011690_11 euxassay_011690_12 euxassay_011690_13 euxassay_011690_14
EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925
euxassay_011690_15 euxassay_011690_16 euxassay_011690_17 euxassay_011690_18 euxassay_011690_19
EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925 EMAGE:17925
euxassay_011690_20 euxassay_011690_21 euxassay_011690_22 euxassay_011690_23 euxassay_011690_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17925Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17925_wholemount_strong.wlz
17925_wholemount_moderate.wlz
17925_wholemount_weak.wlz
17925_wholemount_possible.wlz
17925_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17925_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 13
olfactory cortex ventricular layer
weak weak
regionalweak expression: see section 12 13 17 18
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15 weak expression: see section 11 12 13 16 17 18
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 07 08 09 11 12
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 11 12 moderate expression: see section 06 08 13 14 15 weak expression: see section 09 10
spinal cord ventricular layer
weak weak
regionalweak expression: see section 08
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 12
lower jaw incisor
weak weak
regionalweak expression: see section 10 11 15
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
metanephros
moderate moderate
regionalmoderate expression: see section 04 weak expression: see section 05 06 07 15 16
lung
moderate moderate
regionalmoderate expression: see section 03 04 12 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36502
Entity Detected:Il17rd, interleukin 17 receptor D ( MGI:2159727)
Sequence:sense strand is shown

>T36502
CCAGCCGACTCTTATTCATACCTGGAGAGTCAGCATGTAGGCCTGGACCAAGACACTGAGGCCCAGCCCT
CCTGTGATAGTGCCCCTGCCTTGCAGCCCCTGTTACACGCAGTGAAAGCTGGCAGTCCCTCAGAGATGCC
ACGGGACTCAGGCATATATGATTCTTCTGTACCCTCATCAGAGCTCTCTCTGCCTCTGATGGAGGGACTC
TCTCCGGATCAGATAGAAACATCTTCTCTGACCGAGAGTGTATCTTCCTCCTCTGGCCTAGGTGAGGAGG
ACCCCCCTACCCTCCCTTCCAAGCTCCTTGCCTCTGGGGTGTCCAGAGAACATGGTTGCCACAGCCACAC
TGACGAACTGCAAGCGCTTGCTCCTTTGTAAGGACTCGGAAGAGTCTAAGCATCGCCACTTTAGCTGCTG
ATCTCTCTGGCTCCCCAGTTCACCTCTGTGGTTGTGCAGCCTACTTGGAGCTGAAGGCGCACACGGGGAT
ATCTGGAATGAAATTCTGGCTAGCACTCGATCTGTTCTGCTCCAGCCTTCTAAGGGATACTTAGCAAAGT
CTCCAGTTTCCCAAAAGCATATGGAACCCTGAAAGGCATGTCCATTAGATCTGACTGCAGCTGTCCATCT
CAGACTGATCCTTGGATCTGAGCCTGCTCTGAGAGGGGTAGAGTGGAAACAGGTAACGAGAAATAGGAAA
GCTCCCACACAGCCTGCTCTGGCTTCACTTGAACTCTGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92454. Forward Primer - name:092454_F_cDNA_Il17rd, sequence:CCAGCCGACTCTTATTCATACC; Reverse Primer - name:092454_N_SP6_cDNA_Il17rd, sequence:GCCAGAGTTCAAGTGAAGCCA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17926 same embryo
 EMAGE:17924 same embryo
 EMAGE:17928 same embryo
 EMAGE:17927 same embryo
 EurExpress:euxassay_011690 same experiment
 MGI:4825571 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS